National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31731R-2 
 Symbol CG31731  Full Name CG31731 
 CG No CG31731  Old CG No CG31731 
 Synonyms CG7491, DS00797.5, D00797.5, BG:DS00797.5, CG7559, CG31731 
 Accession No (Link to NCBI) NM_165058.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCACCAGCACTTGGAGTT 
 Primer Seq. 3'
aatctagaggtaccTCAAGACTCTGGCTGTTGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCACCAG CACTTGGAGT TCTTTGCCCA GCTGCGGGGA GCTTGCCGAT CCGATGCACG 
0061 CGATTGGGCA GATGAGAAAC TTAAGAAGCT GGGACTTAGC GATAAGCGAA ACGAATTCGG 
0121 CAAGAATTTG TCTGGAGGCA TGAAGAGGCG TTTATCACTG GGTATCGCCA TTGCCGGTAA 
0181 CACCAAAATC GTAATCCTTG ACGAACCATC ATCGGGATTG GACATTANAC TCGCGTCGTG 
0241 AGCTGTGGGA CATCCTACTT AATCTACGCA AGGAGAAGGC CGTTCTGGTC ACCACGCACT 
0301 ACATGGAGGA GGCCGAGGTC CTTGGGGATA CCATCTGCAT ATTGGCCAAT GGAAAACTGC 
0361 AGAGCATCGG GAGTCCTTTG GAATTAAAAC GAAAATCGGG AATTGGTTAT CGTCTCAAAT 
0421 TAGAGATCAA CGATTTTACA TCAAGAGAAG TGGAAATCAT GGAAATAATC CATCACTTTG 
0481 TGCCAACAGC CAGAGTCTTG A 
 in silico PCR Fragment
0001 ATGTCACCAG CACTTGGAGT TCTTTGCCCA GCTGCGGGGA GCTTGCCGAT CCGATGCACG 
0061 CGATTGGGCA GATGAGAAAC TTAAGAAGCT GGGACTTAGC GATAAGCGAA ACGAATTCGG 
0121 CAAGAATTTG TCTGGAGGCA TGAAGAGGCG TTTATCACTG GGTATCGCCA TTGCCGGTAA 
0181 CACCAAAATC GTAATCCTTG ACGAACCATC ATCGGGATTG GACATTA-AC TCGCGTCGTG 
0241 AGCTGTGGGA CATCCTACTT AATCTACGCA AGGAGAAGGC CGTTCTGGTC ACCACGCACT 
0301 ACATGGAGGA GGCCGAGGTC CTTGGGGATA CCATCTGCAT ATTGGCCAAT GGAAAACTGC 
0361 AGAGCATCGG GAGTCCTTTG GAATTAAAAC GAAAATCGGG AATTGGTTAT CGTCTCAAAT 
0421 TAGAGATCAA CGATTTTACA TCAAGAGAAG TGGAAATCAT GGAAATAATC CATCACTTTG 
0481 TGCCAACAGC CAGAGTCTTG A 
 Assemble Data

31731R-2.IR_full       1   ATGTCACCAGCACTTGGAGTTCTTTGCCCAGCTGCGGGGAGCTTGCCGATCCGATGCACG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     1   ATGTCACCAGCACTTGGAGTTCTTTGCCCAGCTGCGGGGAGCTTGCCGATCCGATGCACG 60


31731R-2.IR_full       61  CGATTGGGCAGATGAGAAACTTAAGAAGCTGGGACTTAGCGATAAGCGAAACGAATTCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     61  CGATTGGGCAGATGAGAAACTTAAGAAGCTGGGACTTAGCGATAAGCGAAACGAATTCGG 120


31731R-2.IR_full       121 CAAGAATTTGTCTGGAGGCATGAAGAGGCGTTTATCACTGGGTATCGCCATTGCCGGTAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     121 CAAGAATTTGTCTGGAGGCATGAAGAGGCGTTTATCACTGGGTATCGCCATTGCCGGTAA 180


31731R-2.IR_full       181 CACCAAAATCGTAATCCTTGACGAACCATCATCGGGATTGGACATTANACTCGCGTCGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
31731R-2.in silico     181 CACCAAAATCGTAATCCTTGACGAACCATCATCGGGATTGGACATTA-ACTCGCGTCGTG 240


31731R-2.IR_full       241 AGCTGTGGGACATCCTACTTAATCTACGCAAGGAGAAGGCCGTTCTGGTCACCACGCACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     241 AGCTGTGGGACATCCTACTTAATCTACGCAAGGAGAAGGCCGTTCTGGTCACCACGCACT 300


31731R-2.IR_full       301 ACATGGAGGAGGCCGAGGTCCTTGGGGATACCATCTGCATATTGGCCAATGGAAAACTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     301 ACATGGAGGAGGCCGAGGTCCTTGGGGATACCATCTGCATATTGGCCAATGGAAAACTGC 360


31731R-2.IR_full       361 AGAGCATCGGGAGTCCTTTGGAATTAAAACGAAAATCGGGAATTGGTTATCGTCTCAAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     361 AGAGCATCGGGAGTCCTTTGGAATTAAAACGAAAATCGGGAATTGGTTATCGTCTCAAAT 420


31731R-2.IR_full       421 TAGAGATCAACGATTTTACATCAAGAGAAGTGGAAATCATGGAAATAATCCATCACTTTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31731R-2.in silico     421 TAGAGATCAACGATTTTACATCAAGAGAAGTGGAAATCATGGAAATAATCCATCACTTTG 480


31731R-2.IR_full       481 TGCCAACAGCCAGAGTCTTGA 501
                           |||||||||||||||||||||
31731R-2.in silico     481 TGCCAACAGCCAGAGTCTTGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001042895.1  CG31731-RB, transcript variant B (CG31731), mRNA 
100   482  NM_165058.3  CG31731-RA, transcript variant A (CG31731), mRNA 
0   NM_167894.1  CG1049-RD, transcript variant D (Cct1), mRNA 
0   NM_167892.1  CG1049-RB, transcript variant B (Cct1), mRNA 
0   NM_167893.1  CG1049-RC, transcript variant C (Cct1), mRNA 
0   NM_139364.2  CG1049-RA, transcript variant A (Cct1), mRNA 
0   NM_169725.1  CG6588-RB, transcript variant B (Fas1), mRNA 
0   NM_169724.1  CG6588-RC, transcript variant C (Fas1), mRNA 
0   NM_169726.1  CG6588-RA, transcript variant A (Fas1), mRNA 
0   NM_140870.1  CG9300-RA (CG9300), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_135951.2  CG4580-RA (CG4580), mRNA 
0   NM_167879.1  CG32331-RA (CG32331), mRNA 
0   NM_165016.1  CG31859-RA (CG31859), mRNA 
0   NM_167365.1  CG1640-RB, transcript variant B (CG1640), mRNA 
0   NM_167366.1  CG1640-RC, transcript variant C (CG1640), mRNA 
0   NM_167367.1  CG1640-RD, transcript variant D (CG1640), mRNA 
0   NM_167368.1  CG1640-RE, transcript variant E (CG1640), mRNA 
0   NM_167369.1  CG1640-RF, transcript variant F (CG1640), mRNA 
0   NM_132651.2  CG1640-RA, transcript variant A (CG1640), mRNA 
0   NM_137573.2  CG10073-RA (CG10073), mRNA 
0   NM_142417.1  CG7794-RA (CG7794), mRNA 
0   NM_134965.2  CG3407-RA (CG3407), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_135238.2  CG10354-RA (CG10354), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_142910.2  CG16710-RA (CG16710), mRNA 
0   NM_135846.2  CG16884-RA (CG16884), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.