National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31643R-2 
 Symbol CG31643  Full Name CG31643 
 CG No CG31643  Old CG No CG31643 
 Synonyms CG31643PA, BcDNA:LD32258, CG31643 
 Accession No (Link to NCBI) NM_164674.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Park J, Lee J, Kim JH, Lee J, Park H, Lim C.
ZNF598 co-translationally titrates poly(GR) protein implicated in the pathogenesis of C9ORF72-associated ALS/FTD.
Nucleic Acids Res (2021) [ PubMed ID = 34551427 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGTATCTGAACCACCTGCCGCGGACACAATGGAAGTACCTACAATACCTTCTGCGAGTGC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTCAGCTTCAGCTCCTGCGACGGCACGTTAACATTGGCGCAAAGCCGCCCATCCAAACAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTGCCTTGCTGCCGGCATTGGGCCAAAAACTGAGGAAGCACTCGCAGCTGGTGAACGGAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCTCCAAGACAAGTTTGGCGTGCCACGGGAACAGGATGCTCTTCTAACCCGACTGGAGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGCCAAGACGGGTAACCAGATTTTAGATGTGTTGGAGAGCTGTGACGGCCTGCAGAGCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCCATGTGGTGATGGGAATCTCACTGCTGTGGAACATCTATCACGACGCGGAGCAGGCAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTAAAGATGCCATCACGGATCGCGTGCTGCTTAACGTGCTCCCAAAGTTGGCCCCTTATG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TACACCAACTGGAGATCGATGATCTCAGTAGATGCTACCTGTACCTGCGCAAAATGCATA 480

31643R-2.IR_full       481 TACCAAACTCCGAGGCAGTC 500
                           |||||||||||||||||||| silico     481 TACCAAACTCCGAGGCAGTC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164674.1  CG31643-RA (CG31643), mRNA 
0   NM_170296.1  CG6330-RA, transcript variant A (CG6330), mRNA 
0   NM_143258.1  CG6330-RB, transcript variant B (CG6330), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_136038.1  CG10178-RA (CG10178), mRNA 
0   NM_169704.1  CG32855-RA (CG32855), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_144123.1  CG13018-RA (CG13018), mRNA 
0   NM_137557.2  CG7229-RA (CG7229), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_135549.3  CG5091-RA (CG5091), mRNA 
0   NM_140733.2  CG6322-RA (CG6322), mRNA 
0   NM_135366.2  CG7781-RA (CG7781), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   NM_169705.1  CG4006-RC, transcript variant C (Akt1), mRNA 
0   NM_169707.1  CG4006-RB, transcript variant B (Akt1), mRNA 
0   NM_169706.1  CG4006-RA, transcript variant A (Akt1), mRNA 
0   NM_168246.1  CG8042-RB, transcript variant B (CG8042), mRNA 
0   NM_079453.2  CG6975-RA (gig), mRNA 
0   NM_079121.2  CG3416-RA (Mov34), mRNA 
0   NM_132528.1  CG1886-RA (ATP7), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   NM_139908.2  CG8042-RA, transcript variant A (CG8042), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_139375.1  CG12105-RA (CG12105), mRNA 
0   NM_137623.2  CG9143-RA (CG9143), mRNA 
0   NM_206789.1  CG33253-RA (CG33253), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.