National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31643R-1 
 Symbol CG31643  Full Name CG31643 
 CG No CG31643  Old CG No CG31643 
 Synonyms CG31643PA, BcDNA:LD32258, CG31643 
 Accession No (Link to NCBI) NM_164674.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Park J, Lee J, Kim JH, Lee J, Park H, Lim C.
ZNF598 co-translationally titrates poly(GR) protein implicated in the pathogenesis of C9ORF72-associated ALS/FTD.
Nucleic Acids Res (2021) [ PubMed ID = 34551427 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTATCTGAACCACCTGCCGC 
 Primer Seq. 3'
aatctagaggtaccGACTGCCTCGGAGTTTGGTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTATCTGAA CCACCTGCCG CGGACACAAT GGAAGTACCT ACAATACCTT CTGCGAGTGC 
0061 GTCAGCTTCA GCTCCTGCGA CGGCACGTTA ACATTGGCGC AAAGCCGCCC ATCCAAACAG 
0121 CTGCCTTGCT GCCGGCATTG GGCCAAAAAC TGAGGAAGCA CTCGCAGCTG GTGAACGGAG 
0181 ATCTCCAAGA CAAGTTTGGC GTGCCACGGG AACAGGATGC TCTTCTAACC CGACTGGAGG 
0241 AGGCCAAGAC GGGTAACCAG ATTTTAGATG TGTTGGAGAG CTGTGACGGC CTGCAGAGCT 
0301 CCCATGTGGT GATGGGAATC TCACTGCTGT GGAACATCTA TCACGACGCG GAGCAGGCAA 
0361 GTAAAGATGC CATCACGGAT CGCGTGCTGC TTAACGTGCT CCCAAAGTTG GCCCCTTATG 
0421 TACACCAACT GGAGATCGAT GATCTCAGTA GATGCTACCT GTACCTGCGC AAAATGCATA 
0481 TACCAAACTC CGAGGCAGTC  
 in silico PCR Fragment
0001 TGTATCTGAA CCACCTGCCG CGGACACAAT GGAAGTACCT ACAATACCTT CTGCGAGTGC 
0061 GTCAGCTTCA GCTCCTGCGA CGGCACGTTA ACATTGGCGC AAAGCCGCCC ATCCAAACAG 
0121 CTGCCTTGCT GCCGGCATTG GGCCAAAAAC TGAGGAAGCA CTCGCAGCTG GTGAACGGAG 
0181 ATCTCCAAGA CAAGTTTGGC GTGCCACGGG AACAGGATGC TCTTCTAACC CGACTGGAGG 
0241 AGGCCAAGAC GGGTAACCAG ATTTTAGATG TGTTGGAGAG CTGTGACGGC CTGCAGAGCT 
0301 CCCATGTGGT GATGGGAATC TCACTGCTGT GGAACATCTA TCACGACGCG GAGCAGGCAA 
0361 GTAAAGATGC CATCACGGAT CGCGTGCTGC TTAACGTGCT CCCAAAGTTG GCCCCTTATG 
0421 TACACCAACT GGAGATCGAT GATCTCAGTA GATGCTACCT GTACCTGCGC AAAATGCATA 
0481 TACCAAACTC CGAGGCAGTC  
 Assemble Data

31643R-1.IR_full       1   TGTATCTGAACCACCTGCCGCGGACACAATGGAAGTACCTACAATACCTTCTGCGAGTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     1   TGTATCTGAACCACCTGCCGCGGACACAATGGAAGTACCTACAATACCTTCTGCGAGTGC 60


31643R-1.IR_full       61  GTCAGCTTCAGCTCCTGCGACGGCACGTTAACATTGGCGCAAAGCCGCCCATCCAAACAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     61  GTCAGCTTCAGCTCCTGCGACGGCACGTTAACATTGGCGCAAAGCCGCCCATCCAAACAG 120


31643R-1.IR_full       121 CTGCCTTGCTGCCGGCATTGGGCCAAAAACTGAGGAAGCACTCGCAGCTGGTGAACGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     121 CTGCCTTGCTGCCGGCATTGGGCCAAAAACTGAGGAAGCACTCGCAGCTGGTGAACGGAG 180


31643R-1.IR_full       181 ATCTCCAAGACAAGTTTGGCGTGCCACGGGAACAGGATGCTCTTCTAACCCGACTGGAGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     181 ATCTCCAAGACAAGTTTGGCGTGCCACGGGAACAGGATGCTCTTCTAACCCGACTGGAGG 240


31643R-1.IR_full       241 AGGCCAAGACGGGTAACCAGATTTTAGATGTGTTGGAGAGCTGTGACGGCCTGCAGAGCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     241 AGGCCAAGACGGGTAACCAGATTTTAGATGTGTTGGAGAGCTGTGACGGCCTGCAGAGCT 300


31643R-1.IR_full       301 CCCATGTGGTGATGGGAATCTCACTGCTGTGGAACATCTATCACGACGCGGAGCAGGCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     301 CCCATGTGGTGATGGGAATCTCACTGCTGTGGAACATCTATCACGACGCGGAGCAGGCAA 360


31643R-1.IR_full       361 GTAAAGATGCCATCACGGATCGCGTGCTGCTTAACGTGCTCCCAAAGTTGGCCCCTTATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     361 GTAAAGATGCCATCACGGATCGCGTGCTGCTTAACGTGCTCCCAAAGTTGGCCCCTTATG 420


31643R-1.IR_full       421 TACACCAACTGGAGATCGATGATCTCAGTAGATGCTACCTGTACCTGCGCAAAATGCATA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31643R-1.in silico     421 TACACCAACTGGAGATCGATGATCTCAGTAGATGCTACCTGTACCTGCGCAAAATGCATA 480


31643R-1.IR_full       481 TACCAAACTCCGAGGCAGTC 500
                           ||||||||||||||||||||
31643R-1.in silico     481 TACCAAACTCCGAGGCAGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164674.1  CG31643-RA (CG31643), mRNA 
0   NM_170296.1  CG6330-RA, transcript variant A (CG6330), mRNA 
0   NM_143258.1  CG6330-RB, transcript variant B (CG6330), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_136038.1  CG10178-RA (CG10178), mRNA 
0   NM_169704.1  CG32855-RA (CG32855), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_144123.1  CG13018-RA (CG13018), mRNA 
0   NM_137557.2  CG7229-RA (CG7229), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 
0   NM_135549.3  CG5091-RA (CG5091), mRNA 
0   NM_140733.2  CG6322-RA (CG6322), mRNA 
0   NM_135366.2  CG7781-RA (CG7781), mRNA 
0   NM_135676.2  CG14940-RA (Pde1c), mRNA 
0   NM_169705.1  CG4006-RC, transcript variant C (Akt1), mRNA 
0   NM_169707.1  CG4006-RB, transcript variant B (Akt1), mRNA 
0   NM_169706.1  CG4006-RA, transcript variant A (Akt1), mRNA 
0   NM_168246.1  CG8042-RB, transcript variant B (CG8042), mRNA 
0   NM_079453.2  CG6975-RA (gig), mRNA 
0   NM_079121.2  CG3416-RA (Mov34), mRNA 
0   NM_132528.1  CG1886-RA (ATP7), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   NM_139908.2  CG8042-RA, transcript variant A (CG8042), mRNA 
0   NM_136102.2  CG10689-RA (CG10689), mRNA 
0   NM_139375.1  CG12105-RA (CG12105), mRNA 
0   NM_137623.2  CG9143-RA (CG9143), mRNA 
0   NM_206789.1  CG33253-RA (CG33253), mRNA 
0   NM_169560.1  CG2988-RA (ems), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.