National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31633R-6 
 Symbol CG31633  Full Name CG31633 
 CG No CG31633  Old CG No CG31633 
 Synonyms CG13770, CG31633 
 Accession No (Link to NCBI) NM_164698.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GACACTCAGTATCCAGTGGCAAAAGATCGAACAGAATGCATACGTGCGATCCATCTGTAT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTGCATGAACTGGAGGAGCTGGAGCTGGACATAGTTTACCTAAACAGGGACAACATCAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAACTGTTGAGCCTGCCTAAACTGATAAAGCTGCGCCTGCACAACTTCTACCAGGTGGA 180

                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| silico     181 CGATCTACTGTGCGAAATTGGAAGCATAAGGGGTCAAGATGTGTT-GACTGCC-GCATTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGTAATAATATCTGGATGAGGCCAACGGAGGTGCTGGCCAAACTGCGAAATCTCCGATGT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     301 TTAACTCTCGTCGATGATGAAGGATGTGCTGCCATTGACTTTTCCACGATCACCTATTGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTCCGCTCTTGGAGCAACTGCATCTGGAGAACTCGCGTATATGGGTCAACGCCGATGGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATATGGGACGTGCTTCTTGCCTGTCCCCGTCTCAGGGAATTCAGCATGATCAACCATGTT 480

31633R-6.IR_full       481 TTGTACGACGAGTTCTTTGCCT 502
                           |||||||||||||||||||||| silico     481 TTGTACGACGAGTTCTTTGCCT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164698.1  CG31633-RA (CG31633), mRNA 
0.2   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0.2   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0.2   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   12  11  39  NM_131995.1  CG15784-RA (CG15784), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_057878.3  CG5179-RA (Cdk9), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_136767.2  CG12936-RA (CG12936), mRNA 
0   NM_165685.1  CG30338-RA (CG30338), mRNA 
0   NM_140971.1  CG5195-RA (CG5195), mRNA 
0   NM_140604.1  CG13048-RA (CG13048), mRNA 
0   NM_142652.2  CG31200-RA (CG31200), mRNA 
0   10  NM_176250.1  CG30275-RD, transcript variant D (CG30275), mRNA 
0   10  NM_145194.1  CG30275-RA, transcript variant A (CG30275), mRNA 
0   10  NM_166544.1  CG30275-RC, transcript variant C (CG30275), mRNA 
0   10  NM_167380.1  CG32628-RA (CG32628), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_141109.1  CG7148-RA (CG7148), mRNA 
0   NM_133165.2  CG1079-RA (CG1079), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_143031.1  CG11375-RA (polybromo), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   16  NM_135596.2  CG7300-RB, transcript variant B (CG7300), mRNA 
0   13  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.