National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31633R-2 
 Symbol CG31633  Full Name CG31633 
 CG No CG31633  Old CG No CG31633 
 Synonyms CG13770, CG31633 
 Accession No (Link to NCBI) NM_164698.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Dui W, Lu W, Ma J, Jiao R.
A systematic phenotypic screen of F-box genes through a tissue-specific RNAi-based approach in Drosophila.
J Genet Genomics (2012) 39(8) 397-413 [ PubMed ID = 22884096 ] [ RRC reference ]

Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS ONE (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACACTCAGTATCCAGTGGCA 
 Primer Seq. 3'
aatctagaggtaccAGGCAAAGAACTCGTCGTACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACACTCAGT ATCCAGTGGC AAAAGATCGA ACAGAATGCA TACGTGCGAT CCATCTGTAT 
0061 GCTGCATGAA CTGGAGGAGC TGGAGCTGGA CATAGTTTAC CTAAACAGGG ACAACATCAG 
0121 CCAACTGTTG AGCCTGCCTA AACTGATAAA GCTGCGCCTG CACAACTTCT ACCAGGTGGA 
0181 CGATCTACTG TGCGAAATTG GAAGCATAAG GGGTCAAGAT GTGTTNGACT GCCTGCATTC 
0241 AGTAATAATA TCTGGATGAG GCCAACGGAG GTGCTGGCCA AACTGCGAAA TCTCCGATGT 
0301 TTAACTCTCG TCGATGATGA AGGATGTGCT GCCATTGACT TTTCCACGAT CACCTATTNC 
0361 TTTCCGCTCT TGGAGCAACT GCATCTGGAG AAcTCGCGTA TATGGGTCAA CGCCGATGGT 
0421 ATATGGGACG TGCTTCTTGC CTGTCCCCGT CTCAGGGAAT TCAGCATGAT CAACCATGTT 
0481 TTGTACGACG AGTTCTTTGC CT 
 in silico PCR Fragment
0001 GACACTCAGT ATCCAGTGGC AAAAGATCGA ACAGAATGCA TACGTGCGAT CCATCTGTAT 
0061 GCTGCATGAA CTGGAGGAGC TGGAGCTGGA CATAGTTTAC CTAAACAGGG ACAACATCAG 
0121 CCAACTGTTG AGCCTGCCTA AACTGATAAA GCTGCGCCTG CACAACTTCT ACCAGGTGGA 
0181 CGATCTACTG TGCGAAATTG GAAGCATAAG GGGTCAAGAT GTGTT-GACT GCC-GCATTC 
0241 AGTAATAATA TCTGGATGAG GCCAACGGAG GTGCTGGCCA AACTGCGAAA TCTCCGATGT 
0301 TTAACTCTCG TCGATGATGA AGGATGTGCT GCCATTGACT TTTCCACGAT CACCTATTGC 
0361 TTTCCGCTCT TGGAGCAACT GCATCTGGAG AACTCGCGTA TATGGGTCAA CGCCGATGGT 
0421 ATATGGGACG TGCTTCTTGC CTGTCCCCGT CTCAGGGAAT TCAGCATGAT CAACCATGTT 
0481 TTGTACGACG AGTTCTTTGC CT 
 Assemble Data

31633R-2.IR_full       1   GACACTCAGTATCCAGTGGCAAAAGATCGAACAGAATGCATACGTGCGATCCATCTGTAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     1   GACACTCAGTATCCAGTGGCAAAAGATCGAACAGAATGCATACGTGCGATCCATCTGTAT 60


31633R-2.IR_full       61  GCTGCATGAACTGGAGGAGCTGGAGCTGGACATAGTTTACCTAAACAGGGACAACATCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     61  GCTGCATGAACTGGAGGAGCTGGAGCTGGACATAGTTTACCTAAACAGGGACAACATCAG 120


31633R-2.IR_full       121 CCAACTGTTGAGCCTGCCTAAACTGATAAAGCTGCGCCTGCACAACTTCTACCAGGTGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     121 CCAACTGTTGAGCCTGCCTAAACTGATAAAGCTGCGCCTGCACAACTTCTACCAGGTGGA 180


31633R-2.IR_full       181 CGATCTACTGTGCGAAATTGGAAGCATAAGGGGTCAAGATGTGTTNGACTGCCTGCATTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||
31633R-2.in silico     181 CGATCTACTGTGCGAAATTGGAAGCATAAGGGGTCAAGATGTGTT-GACTGCC-GCATTC 240


31633R-2.IR_full       241 AGTAATAATATCTGGATGAGGCCAACGGAGGTGCTGGCCAAACTGCGAAATCTCCGATGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     241 AGTAATAATATCTGGATGAGGCCAACGGAGGTGCTGGCCAAACTGCGAAATCTCCGATGT 300


31633R-2.IR_full       301 TTAACTCTCGTCGATGATGAAGGATGTGCTGCCATTGACTTTTCCACGATCACCTATTNC 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
31633R-2.in silico     301 TTAACTCTCGTCGATGATGAAGGATGTGCTGCCATTGACTTTTCCACGATCACCTATTGC 360


31633R-2.IR_full       361 TTTCCGCTCTTGGAGCAACTGCATCTGGAGAACTCGCGTATATGGGTCAACGCCGATGGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     361 TTTCCGCTCTTGGAGCAACTGCATCTGGAGAACTCGCGTATATGGGTCAACGCCGATGGT 420


31633R-2.IR_full       421 ATATGGGACGTGCTTCTTGCCTGTCCCCGTCTCAGGGAATTCAGCATGATCAACCATGTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31633R-2.in silico     421 ATATGGGACGTGCTTCTTGCCTGTCCCCGTCTCAGGGAATTCAGCATGATCAACCATGTT 480


31633R-2.IR_full       481 TTGTACGACGAGTTCTTTGCCT 502
                           ||||||||||||||||||||||
31633R-2.in silico     481 TTGTACGACGAGTTCTTTGCCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164698.1  CG31633-RA (CG31633), mRNA 
0.2   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0.2   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0.2   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   12  11  39  NM_131995.1  CG15784-RA (CG15784), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_134722.1  CG14339-RA (CG14339), mRNA 
0   NM_057878.3  CG5179-RA (Cdk9), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_136767.2  CG12936-RA (CG12936), mRNA 
0   NM_165685.1  CG30338-RA (CG30338), mRNA 
0   NM_140971.1  CG5195-RA (CG5195), mRNA 
0   NM_140604.1  CG13048-RA (CG13048), mRNA 
0   NM_142652.2  CG31200-RA (CG31200), mRNA 
0   10  NM_176250.1  CG30275-RD, transcript variant D (CG30275), mRNA 
0   10  NM_145194.1  CG30275-RA, transcript variant A (CG30275), mRNA 
0   10  NM_166544.1  CG30275-RC, transcript variant C (CG30275), mRNA 
0   10  NM_167380.1  CG32628-RA (CG32628), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_141109.1  CG7148-RA (CG7148), mRNA 
0   NM_133165.2  CG1079-RA (CG1079), mRNA 
0   NM_132896.1  CG9981-RA (CG9981), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_143031.1  CG11375-RA (polybromo), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   16  NM_135596.2  CG7300-RB, transcript variant B (CG7300), mRNA 
0   13  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.