National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3156R-1 
 Symbol CG3156  Full Name CG3156 
 CG No CG3156  Old CG No CG3156 
 Synonyms EG:171D11.2, CG3156 
 Accession No (Link to NCBI) NM_130488.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTGGATTTGCACAGAGCAGC 
 Primer Seq. 3'
aatctagaggtaccGTGCCCACCATTAAGGTATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTGGATTTG CACAGAGCAG CAAGTGGTTA GCCAGGAATG CAAAGGCGAA CTTACCAACT 
0061 GCAGTTGGCA GCCGGAATCG TGCCCGCCCC CGTCAAAATG GGCAGATCCC AGTACGGCCG 
0121 CCTGCTCAGC CTGACTAAAT CGGAGAAATG GGTGCTGACA GCGGGCATTG GCTGTCTGGT 
0181 AGTTTCTTCA GCTATCACCA TGTCGGTTCC TCTGTTCCTG GGCAAGGTCA TTGATGTAGT 
0241 CTTTAATAAA TCGGGCATGG ATAGCGCAGC CATGGCCAAA TTGGGCGAGT ACTCGGTGCT 
0301 GCTCTTCGGG ATCTTCGTGC TGGGCGGATT CGCCAACTTT GCCCGCGTCC ATCTGTTTGG 
0361 GAATGCGGCT CTCCGAATAG TGCGCAGTCT AAGATCCCGG CTATACAGAT CTATGCTTAT 
0421 GCAGGAGGTG GGTTGGTTCG ATACCAAGGG CACTGGAGAA CTAATAAATC GGCTGAGCAA 
0481 CGATACCTTA ATGGTGGGCA C 
 in silico PCR Fragment
0001 CGTGGATTTG CACAGAGCAG CAAGTGGTTA GCCAGGAATG CAAAGGCGAA CTTACCAACT 
0061 GCAGTTGG-A GCCGGAATCG TGCCCGCCCC CGTCAAAATG GGCAGATCCC AGTACGGCCG 
0121 CCTGCTCAGC CTGACTAAAT CGGAGAAATG GGTGCTGACA GCGGGCATTG GCTGTCTGGT 
0181 AGTTTCTTCA GCTATCACCA TGTCGGTTCC TCTGTTCCTG GGCAAGGTCA TTGATGTAGT 
0241 CTTTAATAAA TCGGGCATGG ATAGCGCAGC CATGGCCAAA TTGGGCGAGT ACTCGGTGCT 
0301 GCTCTTCGGG ATCTTCGTGC TGGGCGGATT CGCCAACTTT GCCCGCGTCC ATCTGTTTGG 
0361 GAATGCGGCT CTCCGAATAG TGCGCAGTCT AAGATCCCGG CTATACAGAT CTATGCTTAT 
0421 GCAGGAGGTG GGTTGGTTCG ATACCAAGGG CACTGGAGAA CTAATAAATC GGCTGAGCAA 
0481 CGATACCTTA ATGGTGGGCA C 
 Assemble Data

3156R-1.IR_full       1   CGTGGATTTGCACAGAGCAGCAAGTGGTTAGCCAGGAATGCAAAGGCGAACTTACCAACT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     1   CGTGGATTTGCACAGAGCAGCAAGTGGTTAGCCAGGAATGCAAAGGCGAACTTACCAACT 60


3156R-1.IR_full       61  GCAGTTGGCAGCCGGAATCGTGCCCGCCCCCGTCAAAATGGGCAGATCCCAGTACGGCCG 120
                          |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     61  GCAGTTGG-AGCCGGAATCGTGCCCGCCCCCGTCAAAATGGGCAGATCCCAGTACGGCCG 120


3156R-1.IR_full       121 CCTGCTCAGCCTGACTAAATCGGAGAAATGGGTGCTGACAGCGGGCATTGGCTGTCTGGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     121 CCTGCTCAGCCTGACTAAATCGGAGAAATGGGTGCTGACAGCGGGCATTGGCTGTCTGGT 180


3156R-1.IR_full       181 AGTTTCTTCAGCTATCACCATGTCGGTTCCTCTGTTCCTGGGCAAGGTCATTGATGTAGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     181 AGTTTCTTCAGCTATCACCATGTCGGTTCCTCTGTTCCTGGGCAAGGTCATTGATGTAGT 240


3156R-1.IR_full       241 CTTTAATAAATCGGGCATGGATAGCGCAGCCATGGCCAAATTGGGCGAGTACTCGGTGCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     241 CTTTAATAAATCGGGCATGGATAGCGCAGCCATGGCCAAATTGGGCGAGTACTCGGTGCT 300


3156R-1.IR_full       301 GCTCTTCGGGATCTTCGTGCTGGGCGGATTCGCCAACTTTGCCCGCGTCCATCTGTTTGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     301 GCTCTTCGGGATCTTCGTGCTGGGCGGATTCGCCAACTTTGCCCGCGTCCATCTGTTTGG 360


3156R-1.IR_full       361 GAATGCGGCTCTCCGAATAGTGCGCAGTCTAAGATCCCGGCTATACAGATCTATGCTTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     361 GAATGCGGCTCTCCGAATAGTGCGCAGTCTAAGATCCCGGCTATACAGATCTATGCTTAT 420


3156R-1.IR_full       421 GCAGGAGGTGGGTTGGTTCGATACCAAGGGCACTGGAGAACTAATAAATCGGCTGAGCAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3156R-1.in silico     421 GCAGGAGGTGGGTTGGTTCGATACCAAGGGCACTGGAGAACTAATAAATCGGCTGAGCAA 480


3156R-1.IR_full       481 CGATACCTTAATGGTGGGCAC 501
                          |||||||||||||||||||||
3156R-1.in silico     481 CGATACCTTAATGGTGGGCAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130488.2  CG3156-RA (CG3156), mRNA 
0   NM_136598.2  CG8196-RA (Ance-4), mRNA 
0   NM_078569.2  CG1554-RA (RpII215), mRNA 
0   NM_166049.1  CG8151-RC, transcript variant C (Tfb1), mRNA 
0   NM_166048.1  CG8151-RA, transcript variant A (Tfb1), mRNA 
0   NM_137113.2  CG8151-RB, transcript variant B (Tfb1), mRNA 
0   NM_141378.2  CG1155-RA (Osi14), mRNA 
0   NM_168411.1  CG32064-RA (CG32064), mRNA 
0   NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0   NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0   NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0   NM_143336.1  CG5003-RA (CG5003), mRNA 
0   NM_141372.1  CG15593-RB, transcript variant B (Osi10), mRNA 
0   NM_135895.2  CG15269-RA (CG15269), mRNA 
0   NM_169131.1  CG15593-RA, transcript variant A (Osi10), mRNA 
0   NM_143104.1  CG11856-RA (Nup358), mRNA 
0   NM_057923.2  CG6708-RA (Osbp), mRNA 
0   NM_166689.1  CG3629-RB, transcript variant B (Dll), mRNA 
0   NM_079133.1  CG3629-RA, transcript variant A (Dll), mRNA 
0   NM_140736.2  CG7555-RA, transcript variant A (Nedd4), mRNA 
0   NM_206394.1  CG7555-RD, transcript variant D (Nedd4), mRNA 
0   NM_168737.1  CG7555-RB, transcript variant B (Nedd4), mRNA 
0   NM_168736.1  CG7555-RC, transcript variant C (Nedd4), mRNA 
0   NM_136691.2  CG1441-RB, transcript variant B (CG1441), mRNA 
0   NM_165720.2  CG1441-RA, transcript variant A (CG1441), mRNA 
0   NM_001014667.1  CG4685-RB, transcript variant B (CG4685), mRNA 
0   NM_001014666.1  CG4685-RC, transcript variant C (CG4685), mRNA 
0   NM_143151.2  CG4685-RA, transcript variant A (CG4685), mRNA 
0   NM_001014665.1  CG4685-RD, transcript variant D (CG4685), mRNA 
0   10  NM_139971.1  CG6915-RA (CG6915), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.