National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3152R-1 
 Symbol Trap1  Full Name Trap1 
 CG No CG3152  Old CG No CG3152 
 Synonyms TRAP1, dtrap-1, TRAP1dr, CG3152, Trap1 
 Accession No (Link to NCBI) NM_058091.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Zhang L, Karsten P, Hamm S, Pogson JH, Müller-Rischart AK, Exner N, Haass C, Whitworth AJ, Winklhofer KF, Schulz JB, Voigt A.
TRAP1 rescues PINK1 loss-of-function phenotypes.
Hum. Mol. Genet. (2013) 22(14) 2829-41 [ PubMed ID = 23525905 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCTGTACGAGCGATGGGA 
 Primer Seq. 3'
aatctagaggtaccAGGAACTTCTTCGAGCCGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCTGTAC GAGCGATGGG AGTGCTGGGN CCAGGCGTGC CGCCTCGGTC GCTGTGCCCA 
0061 AGTGTTGAGG CAGAGTCACC GATCCGCCCC AGCAGCGTTC AATATCACCC TTGGATCGCA 
0121 GCATTCGCCG GGTGCTCTCT CGCTCCGTCG CTACTCCACG GAGACCAAGC AGGCATCAGG 
0181 ATCAGTGGTG GACAAGCATG AGTTCCAGGC AGAGACGCGC CAGCTACTTG ACATTGTGGC 
0241 TCGTTCCTTA TACTNCCGAC CACGAGGTCT TTGTGCGCGA GCTTATTTCG AATGCAAGCG 
0301 ATGCGCTGGA GAAATTTCGG TACACCTCGT TGAGCGCTGG AGGCGAGAAT CTGGCTGGAA 
0361 AGGACCGGCC TCTGGAGATT CGTATCACCA CCGACAAGCC ACTGATGCAG CTAATCATCC 
0421 AGGACACGGG CATCGGCATG ACCAAGGAGG AGCTGGTCAG CAACCTGGGC ACCATTGCAC 
0481 GCAGCGGCTC GAAGAAGTTC CT 
 in silico PCR Fragment
0001 ATGTCTGTAC GAGCGATGGG AGTGCTGGG- CCAGGCGTGC CGCCTCGGTC GCTGTGCCCA 
0061 AGTGTTGAGG CAGAGTCACC GATCCGCCCC AGCAGCGTTC AATATCACCA TTGGATCGCA 
0121 GCATTCGCCG GGTGCTCTCT CGCTCCGTCG CTACTCCACG GAGACCAAGC AGGCATCAGG 
0181 ATCAGTGGTG GACAAGCATG AGTTCCAGGC AGAGACGCGC CAGCTACTTG ACATTGTGGC 
0241 TCGTTCCTTA TACT-CCGAC CACGAGGTCT TTGTGCGCGA GCTTATTTCG AATGCAAGCG 
0301 ATGCGCTGGA GAAATTTCGG TACACCTCGT TGAGCGCTGG AGGCGAGAAT CTGGCTGGAA 
0361 AGGACCGGCC TCTGGAGATT CGTATCACCA CCGACAAGCC ACTGATGCAG CTAATCATCC 
0421 AGGACACGGG CATCGGCATG ACCAAGGAGG AGCTGGTCAG CAACCTGGGC ACCATTGCAC 
0481 GCAGCGGCTC GAAGAAGTTC CT 
 Assemble Data

3152R-1.IR_full       1   ATGTCTGTACGAGCGATGGGAGTGCTGGGNCCAGGCGTGCCGCCTCGGTCGCTGTGCCCA 60
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
3152R-1.in silico     1   ATGTCTGTACGAGCGATGGGAGTGCTGGG-CCAGGCGTGCCGCCTCGGTCGCTGTGCCCA 60


3152R-1.IR_full       61  AGTGTTGAGGCAGAGTCACCGATCCGCCCCAGCAGCGTTCAATATCACCCTTGGATCGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3152R-1.in silico     61  AGTGTTGAGGCAGAGTCACCGATCCGCCCCAGCAGCGTTCAATATCACCATTGGATCGCA 120


3152R-1.IR_full       121 GCATTCGCCGGGTGCTCTCTCGCTCCGTCGCTACTCCACGGAGACCAAGCAGGCATCAGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     121 GCATTCGCCGGGTGCTCTCTCGCTCCGTCGCTACTCCACGGAGACCAAGCAGGCATCAGG 180


3152R-1.IR_full       181 ATCAGTGGTGGACAAGCATGAGTTCCAGGCAGAGACGCGCCAGCTACTTGACATTGTGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     181 ATCAGTGGTGGACAAGCATGAGTTCCAGGCAGAGACGCGCCAGCTACTTGACATTGTGGC 240


3152R-1.IR_full       241 TCGTTCCTTATACTNCCGACCACGAGGTCTTTGTGCGCGAGCTTATTTCGAATGCAAGCG 300
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     241 TCGTTCCTTATACT-CCGACCACGAGGTCTTTGTGCGCGAGCTTATTTCGAATGCAAGCG 300


3152R-1.IR_full       301 ATGCGCTGGAGAAATTTCGGTACACCTCGTTGAGCGCTGGAGGCGAGAATCTGGCTGGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     301 ATGCGCTGGAGAAATTTCGGTACACCTCGTTGAGCGCTGGAGGCGAGAATCTGGCTGGAA 360


3152R-1.IR_full       361 AGGACCGGCCTCTGGAGATTCGTATCACCACCGACAAGCCACTGATGCAGCTAATCATCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     361 AGGACCGGCCTCTGGAGATTCGTATCACCACCGACAAGCCACTGATGCAGCTAATCATCC 420


3152R-1.IR_full       421 AGGACACGGGCATCGGCATGACCAAGGAGGAGCTGGTCAGCAACCTGGGCACCATTGCAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3152R-1.in silico     421 AGGACACGGGCATCGGCATGACCAAGGAGGAGCTGGTCAGCAACCTGGGCACCATTGCAC 480


3152R-1.IR_full       481 GCAGCGGCTCGAAGAAGTTCCT 502
                          ||||||||||||||||||||||
3152R-1.in silico     481 GCAGCGGCTCGAAGAAGTTCCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058091.3  CG3152-RA (Trap1), mRNA 
0.82   NM_136647.2  CG8809-RA (Camta), mRNA 
0   NM_078827.1  CG4977-RA (kek2), mRNA 
0   NM_168629.2  CG32149-RC, transcript variant C (RhoGAP71E), mRNA 
0   NM_140527.2  CG32149-RA, transcript variant A (RhoGAP71E), mRNA 
0   NM_168630.1  CG32149-RB, transcript variant B (RhoGAP71E), mRNA 
0   NM_079973.2  CG10939-RA (Sip1), mRNA 
0   NM_136993.2  CG3955-RA (CG3955), mRNA 
0   NM_132796.2  CG11655-RA (CG11655), mRNA 
0   NM_168614.2  CG6988-RD, transcript variant D (Pdi), mRNA 
0   NM_079355.2  CG6988-RA, transcript variant A (Pdi), mRNA 
0   NM_165325.1  CG10076-RC, transcript variant C (spir), mRNA 
0   NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
0   NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
0   NM_137484.2  CG17530-RA (GstE6), mRNA 
0   NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 
0   NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
0   NM_132640.2  CG1770-RA, transcript variant A (HDAC4), mRNA 
0   NM_134883.2  CG8813-RA (CG8813), mRNA 
0   NM_137242.2  CG8430-RA, transcript variant A (Got1), mRNA 
0   NM_166148.1  CG8430-RB, transcript variant B (Got1), mRNA 
0   NM_143313.1  CG5639-RA (CG5639), mRNA 
0   NM_137121.1  CG17388-RA (CG17388), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 
0   NM_078932.2  CG17853-RA (Or43b), mRNA 
0   NM_139489.1  CG9977-RA (CG9977), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_139456.2  CG8985-RA (DmsR-1), mRNA 
0   NM_140689.3  CG6652-RA, transcript variant A (CG6652), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.