National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31525R-2 
 Symbol CG31525  Full Name CG31525 
 CG No CG31525  Old CG No CG31525 
 Synonyms CG31525 
 Accession No (Link to NCBI) NM_168998.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACGCAAAGCTGCAGAGTCCC 
 Primer Seq. 3'
aatctagaggtaccTGTCGGCAGGACAGAGTGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AACGCAAAgN TGCAGAGTCC CGGCTAAgGG CCACAAAGGA AGCAAGTCAG AAGAATTGGC 
0061 CCAGGATAAT AGAAGTTATA CCGATTCCCC CAATCTCTCG TTCGACTAAT TCAACTAGCT 
0121 CAAAGGAAAC ATACTCAAAG AAAAAAGATA TAGGTATGTC CCAGACGACT TTAGATGGAA 
0181 AGAATGAGAA GGAAAAAACT CCGTCTTTGG AACAGTCAAT CCACGAATCC GAAAAGAAAA 
0241 TTCAGCTGTG TGATGCTCTG NACAAAAAAT TCGATTAACT AGTCACAAGA AAACCTTCTT 
0301 GTCGGAAATA AAAAAGAAGG CTTTTGACGC GGAACAATTC CAAAATACCA CTTCATCCGG 
0361 ATATGATAAG GACAATAAAT TTATTGCACT GGTTCCAAGG AACACCAATA AAGGGGCCAA 
0421 TAAAACTCCA AACTCCAGCG TGCCATTGAT GTCCAAATTT TGCGAACAAA TTAAGTCGCA 
0481 CTTCCACTNC TGTCCTGCCG NCa 
 in silico PCR Fragment
0001 AACGCAAAGC TGCAGAGTCC CGGCTAAGGG CCACAAAGGA AGCAAGTCAG AAGAATTGGC 
0061 CCAGGATAAT AGAAGTTATA CCGATTCCCC CAATCTCTCG TTCGACTAAT TCAACTAGCT 
0121 CAAAGGAAAC ATACTCAAAG AAAAAAGATA TAGGTATGTC CCAGACGACT TTAGATGGAA 
0181 AGAATGAGAA GGAAAAAACT CCGTCTTTGG AACAGTCAAT CCACGAATCC GAAAAGAAAA 
0241 TTCAGCTGTG TGATGCTCTG --CAAAAAAT TCGATTAACT AGTCACAAGA AAACCTTCTT 
0301 GTCGGAAATA AAAAAGAAGG CTTTTGACGC GGAACAATTC CAAAATACCA CTTCATCCGG 
0361 ATATGATAAG GACAATAAAT TTATTGCACT GGTTCCAAGG AACACCAATA AAGGGGCCAA 
0421 TAAAACTCCA AACTCCAGCG TGCCATTGAT GTCCAAATTT TGCGAACAAA TTAAGTCGCA 
0481 CTTCCACT-C TGTCCTGCCG ACA 
 Assemble Data

31525R-2.IR_full       1   AACGCAAAGNTGCAGAGTCCCGGCTAAGGGCCACAAAGGAAGCAAGTCAGAAGAATTGGC 60
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     1   AACGCAAAGCTGCAGAGTCCCGGCTAAGGGCCACAAAGGAAGCAAGTCAGAAGAATTGGC 60


31525R-2.IR_full       61  CCAGGATAATAGAAGTTATACCGATTCCCCCAATCTCTCGTTCGACTAATTCAACTAGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     61  CCAGGATAATAGAAGTTATACCGATTCCCCCAATCTCTCGTTCGACTAATTCAACTAGCT 120


31525R-2.IR_full       121 CAAAGGAAACATACTCAAAGAAAAAAGATATAGGTATGTCCCAGACGACTTTAGATGGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     121 CAAAGGAAACATACTCAAAGAAAAAAGATATAGGTATGTCCCAGACGACTTTAGATGGAA 180


31525R-2.IR_full       181 AGAATGAGAAGGAAAAAACTCCGTCTTTGGAACAGTCAATCCACGAATCCGAAAAGAAAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     181 AGAATGAGAAGGAAAAAACTCCGTCTTTGGAACAGTCAATCCACGAATCCGAAAAGAAAA 240


31525R-2.IR_full       241 TTCAGCTGTGTGATGCTCTGNACAAAAAATTCGATTAACTAGTCACAAGAAAACCTTCTT 300
                           ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     241 TTCAGCTGTGTGATGCTCTG--CAAAAAATTCGATTAACTAGTCACAAGAAAACCTTCTT 300


31525R-2.IR_full       301 GTCGGAAATAAAAAAGAAGGCTTTTGACGCGGAACAATTCCAAAATACCACTTCATCCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     301 GTCGGAAATAAAAAAGAAGGCTTTTGACGCGGAACAATTCCAAAATACCACTTCATCCGG 360


31525R-2.IR_full       361 ATATGATAAGGACAATAAATTTATTGCACTGGTTCCAAGGAACACCAATAAAGGGGCCAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     361 ATATGATAAGGACAATAAATTTATTGCACTGGTTCCAAGGAACACCAATAAAGGGGCCAA 420


31525R-2.IR_full       421 TAAAACTCCAAACTCCAGCGTGCCATTGATGTCCAAATTTTGCGAACAAATTAAGTCGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31525R-2.in silico     421 TAAAACTCCAAACTCCAGCGTGCCATTGATGTCCAAATTTTGCGAACAAATTAAGTCGCA 480


31525R-2.IR_full       481 CTTCCACTNCTGTCCTGCCGNCA 503
                           |||||||| ||||||||||| ||
31525R-2.in silico     481 CTTCCACT-CTGTCCTGCCGACA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_168998.2  CG31525-RA (CG31525), mRNA 
0   NM_080528.2  CG9670-RA (fal), mRNA 
0   NM_130487.2  CG18273-RA (CG18273), mRNA 
0   NM_135266.3  CG5149-RA (CG5149), mRNA 
0   NM_136981.3  CG13319-RA (CG13319), mRNA 
0   NM_079251.2  CG6253-RA (RpL14), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_078600.2  CG10521-RA (NetB), mRNA 
0   NM_165438.1  CG30438-RD, transcript variant D (CG30438), mRNA 
0   NM_165437.1  CG30438-RC, transcript variant C (CG30438), mRNA 
0   NM_165435.1  CG30438-RA, transcript variant A (CG30438), mRNA 
0   NM_165436.1  CG30438-RB, transcript variant B (CG30438), mRNA 
0   NM_135061.2  CG18174-RA (Rpn11), mRNA 
0   22  66  NR_002068.3  CG18174-RA (Rpn11), mRNA, miscRNA 
0   NM_137339.2  CG9646-RA (CG9646), mRNA 
0   10  NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_136821.2  CG13213-RA, transcript variant A (CG13213), mRNA 
0   NM_165815.1  CG13213-RB, transcript variant B (CG13213), mRNA 
0   NM_165816.1  CG13213-RC, transcript variant C (CG13213), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_079260.1  CG4978-RA (Mcm7), mRNA 
0   NM_057316.3  CG5581-RA (Ote), mRNA 
0   NM_167364.1  CG15747-RA (CG15747), mRNA 
0   NM_136723.1  CG12913-RA (CG12913), mRNA 
0   NM_168115.1  CG10645-RA, transcript variant A (lama), mRNA 
0   NM_137051.1  CG13337-RA (CG13337), mRNA 
0   NM_140031.1  CG4821-RA, transcript variant A (Tequila), mRNA 
0   NM_136156.1  CG10463-RA (CG10463), mRNA 
0   NM_140357.2  CG10752-RA (CG10752), mRNA 
0   NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.