National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31449R-2 
 Symbol Hsp70Ba  Full Name Heat-shock-protein-70Ba 
 CG No CG31449  Old CG No CG31449 
 Synonyms Hsp70, hsp70, HSP70, hsp70B, hsp70Ba, Hsp70B, Hsp 70, dhsp70, Hsp70(87C), hsp-70, hsp70 87C, CG31449, Hsp70Ba 
 Accession No (Link to NCBI) NM_169469.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGATCTGGGCACCACCTACT 
 Primer Seq. 3'
aatctagaggtaccCTCATTGATGATGCGGAGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGATCTGGG CACCACCTAC TCNTGCNTGG GTGTCTACCA GCATGGCAAG GTTGAGATTA 
0061 TCGCCAATGA CCAGGGCAAC CGCACCACGC CGTCCTACGT GGCTTTCACA GACTCGGAAC 
0121 GCCTCATTGG TGATCCGGCC AAGAACCAGG TGGCCATGAA CCCCAGAAAC ACAGTGTTTG 
0181 ACGCCAAGCG ACTCATCGGC CGAAAATACG ACGATACCCA AAATCGCAGA GGACATGAAG 
0241 CACTNGGCCT TTCAAAGTTG TAAGCGACGG CGGAAAGCCC AAGATCGGGG TGGAGTATAA 
0301 GGGTGAGTCC AAGAGATTTG CTCCCGAGGA GATCAGTTCG ATGGTGCTGA CCAAGATGAA 
0361 GGAGACGGCG GAGGCGTATC TGGGCGAGAG CATCACGGAT GCAGTCATCA CAGTTCCAGC 
0421 TTACTTCAAC GACTCNNANC GCCAGGCTAC CANANACgCC GGTCACATCG CCGGCCTGAA 
0481 tgTGNTCNGC ATCATCANTG AG 
 in silico PCR Fragment
0001 TCGATCTGGG CACCACCTAC TCCTGCGTGG GTGTCTACCA GCATGGCAAG GTTGAGATTA 
0061 TCGCCAATGA CCAGGGCAAC CGCACCACGC CGTCCTACGT GGCTTTCACA GACTCGGAAC 
0121 GCCTCATTGG TGATCCGGCC AAGAACCAGG TGGCCATGAA CCCCAGAAAC ACAGTGTTTG 
0181 ACGCCAAGCG ACTCATCGGC CGAAAATACG ACGAT-CCAA AAATCGCAGA GGACATGAAG 
0241 CACT-GGCCT TTCAAAGTTG TAAGCGACGG CGGAAAGCCC AAGATCGGGG TGGAGTATAA 
0301 GGGTGAGTCC AAGAGATTTG CTCCCGAGGA GATCAGTTCG ATGGTGCTGA CCAAGATGAA 
0361 GGAGACGGCG GAGGCGTATC TGGGCGAGAG CATCACGGAT GCAGTCATCA CAGTTCCAGC 
0421 TTACTTCAAC GACTCTCAGC GCCAGGCTAC CAAAGACGCC GGTCACATCG CCGGCCTGAA 
0481 TGTGCTCCGC ATCATCAATG AG 
 Assemble Data

31449R-2.IR_full       1   TCGATCTGGGCACCACCTACTCNTGCNTGGGTGTCTACCAGCATGGCAAGGTTGAGATTA 60
                           |||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||
31449R-2.in silico     1   TCGATCTGGGCACCACCTACTCCTGCGTGGGTGTCTACCAGCATGGCAAGGTTGAGATTA 60


31449R-2.IR_full       61  TCGCCAATGACCAGGGCAACCGCACCACGCCGTCCTACGTGGCTTTCACAGACTCGGAAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31449R-2.in silico     61  TCGCCAATGACCAGGGCAACCGCACCACGCCGTCCTACGTGGCTTTCACAGACTCGGAAC 120


31449R-2.IR_full       121 GCCTCATTGGTGATCCGGCCAAGAACCAGGTGGCCATGAACCCCAGAAACACAGTGTTTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31449R-2.in silico     121 GCCTCATTGGTGATCCGGCCAAGAACCAGGTGGCCATGAACCCCAGAAACACAGTGTTTG 180


31449R-2.IR_full       181 ACGCCAAGCGACTCATCGGCCGAAAATACGACGATACCCAAAATCGCAGAGGACATGAAG 240
                           ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
31449R-2.in silico     181 ACGCCAAGCGACTCATCGGCCGAAAATACGACGAT-CCAAAAATCGCAGAGGACATGAAG 240


31449R-2.IR_full       241 CACTNGGCCTTTCAAAGTTGTAAGCGACGGCGGAAAGCCCAAGATCGGGGTGGAGTATAA 300
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
31449R-2.in silico     241 CACT-GGCCTTTCAAAGTTGTAAGCGACGGCGGAAAGCCCAAGATCGGGGTGGAGTATAA 300


31449R-2.IR_full       301 GGGTGAGTCCAAGAGATTTGCTCCCGAGGAGATCAGTTCGATGGTGCTGACCAAGATGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31449R-2.in silico     301 GGGTGAGTCCAAGAGATTTGCTCCCGAGGAGATCAGTTCGATGGTGCTGACCAAGATGAA 360


31449R-2.IR_full       361 GGAGACGGCGGAGGCGTATCTGGGCGAGAGCATCACGGATGCAGTCATCACAGTTCCAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31449R-2.in silico     361 GGAGACGGCGGAGGCGTATCTGGGCGAGAGCATCACGGATGCAGTCATCACAGTTCCAGC 420


31449R-2.IR_full       421 TTACTTCAACGACTCNNANCGCCAGGCTACCANANACGCCGGTCACATCGCCGGCCTGAA 480
                           |||||||||||||||  | ||||||||||||| | |||||||||||||||||||||||||
31449R-2.in silico     421 TTACTTCAACGACTCTCAGCGCCAGGCTACCAAAGACGCCGGTCACATCGCCGGCCTGAA 480


31449R-2.IR_full       481 TGTGNTCNGCATCATCANTGAG 502
                           |||| || ||||||||| ||||
31449R-2.in silico     481 TGTGCTCCGCATCATCAATGAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.