National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31419R-1 
 Symbol CG31419  Full Name CG31419 
 CG No CG31419  Old CG No CG31419 
 Synonyms CG5329, CG31419 
 Accession No (Link to NCBI) NM_169754.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCCTGGCAGGACGAAGGCT 
 Primer Seq. 3'
aatctagaggtaccGTGCTTCGTGTCGATGCCTCA 
 Predicted Fragment Size
459 
 IR fragment full Seq
0001 GATCCTGGCA GGACGAAGGC TTCGGCAAGG CAAAGGCAAG AGCTGGCCTG GTCGATGGGA 
0061 TAGAGTGCAG GGATGGTGAG GTGAGGACTC CATTTGGCTG CTCAACGCCA CCGTACCCAC 
0121 CGCACAGAGA ATCAGATCGA GTCCCAGTGC ACCACAGCAG CTTGTACCGC GAGCAGGTGG 
0181 TGCACTCCAA TTACGGATCG GCACGTAGCG TCCATCAAGA AAAGGTCAAG ATCGAAAAAG 
0241 GAAAAAGGCA GCCATACTTG GGTCCCCCCA TTTCGGGGCA TAATATTCCC CGAAAGAATT 
0301 ACATCCTGCC GGGCAGGCTG CTCCGAAGCG ACCGTCAGTG TCGCCCATAT GAGAGCCCCG 
0361 GGAAGGATGG GCAATGCCAT CCAAAGAAGG GTAAAACGGG AAATTACAAG CACACAAACC 
0421 ACGTCTATGG ACTCCAATTG AGGCATCGAC ACGAAGCAC 
 in silico PCR Fragment
0001 GATCCTGGCA GGACGAAGGC TTCGGCAAGG CAAAGGCAAG AGCTGGCCTG GTCGATGGGA 
0061 TAGAGTGCAG GGATGGTGAG GTGAGGACTC CATTTGGCTG CTCAACGCCA CCGTACCCAC 
0121 CGCACAGAGA ATCAGATCGA GTCCCAGTGC ACCACAGCAG CTTGTACCGC GAGCAGGTGG 
0181 TGCACTCCAA TTACGGATCG GCACGTAGCG TCCATCAAGA AAAGGTCAAG ATCGAAAAAG 
0241 GAAAAAGGCA GCCATACTTG GGTCCCCCCA TTTCGGGGCA TAATATTCCC CGAAAGAATT 
0301 ACATCCTGCC GGGCAGGCTG CTCCGAAGCG ACCGTCAGTG TCGCCCATAT GAGAGCCCCG 
0361 GGAAGGATGG GCAATGCCAT CCAAAGAAGG GTAAAACGGG AAATTACAAG CACACAAACC 
0421 ACGTCTATGG ACTCCAATTG AGGCATCGAC ACGAAGCAC 
 Assemble Data

31419R-1.IR_full       1   GATCCTGGCAGGACGAAGGCTTCGGCAAGGCAAAGGCAAGAGCTGGCCTGGTCGATGGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     1   GATCCTGGCAGGACGAAGGCTTCGGCAAGGCAAAGGCAAGAGCTGGCCTGGTCGATGGGA 60


31419R-1.IR_full       61  TAGAGTGCAGGGATGGTGAGGTGAGGACTCCATTTGGCTGCTCAACGCCACCGTACCCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     61  TAGAGTGCAGGGATGGTGAGGTGAGGACTCCATTTGGCTGCTCAACGCCACCGTACCCAC 120


31419R-1.IR_full       121 CGCACAGAGAATCAGATCGAGTCCCAGTGCACCACAGCAGCTTGTACCGCGAGCAGGTGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     121 CGCACAGAGAATCAGATCGAGTCCCAGTGCACCACAGCAGCTTGTACCGCGAGCAGGTGG 180


31419R-1.IR_full       181 TGCACTCCAATTACGGATCGGCACGTAGCGTCCATCAAGAAAAGGTCAAGATCGAAAAAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     181 TGCACTCCAATTACGGATCGGCACGTAGCGTCCATCAAGAAAAGGTCAAGATCGAAAAAG 240


31419R-1.IR_full       241 GAAAAAGGCAGCCATACTTGGGTCCCCCCATTTCGGGGCATAATATTCCCCGAAAGAATT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     241 GAAAAAGGCAGCCATACTTGGGTCCCCCCATTTCGGGGCATAATATTCCCCGAAAGAATT 300


31419R-1.IR_full       301 ACATCCTGCCGGGCAGGCTGCTCCGAAGCGACCGTCAGTGTCGCCCATATGAGAGCCCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     301 ACATCCTGCCGGGCAGGCTGCTCCGAAGCGACCGTCAGTGTCGCCCATATGAGAGCCCCG 360


31419R-1.IR_full       361 GGAAGGATGGGCAATGCCATCCAAAGAAGGGTAAAACGGGAAATTACAAGCACACAAACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     361 GGAAGGATGGGCAATGCCATCCAAAGAAGGGTAAAACGGGAAATTACAAGCACACAAACC 420


31419R-1.IR_full       421 ACGTCTATGGACTCCAATTGAGGCATCGACACGAAGCAC 459
                           |||||||||||||||||||||||||||||||||||||||
31419R-1.in silico     421 ACGTCTATGGACTCCAATTGAGGCATCGACACGAAGCAC 459

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   441  NM_169754.1  CG31419-RA (CG31419), mRNA 
0.45   19  56  15  NM_142358.2  CG31418-RA (CG31418), mRNA 
0   NM_169223.2  CG31369-RA (PQBP-1), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_136806.2  CG9080-RA (CG9080), mRNA 
0   16  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   12  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_165611.1  CG8643-RA (rgr), mRNA 
0   10  NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   10  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   10  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   NM_140310.1  CG4328-RA (CG4328), mRNA 
0   NM_140732.1  CG7571-RA (Oatp74D), mRNA 
0   NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   NM_169131.1  CG15593-RA, transcript variant A (Osi10), mRNA 
0   NM_141372.1  CG15593-RB, transcript variant B (Osi10), mRNA 
0   NM_132508.2  CG1703-RA (CG1703), mRNA 
0   NM_165142.1  CG31736-RA (CG31736), mRNA 
0   NM_137051.1  CG13337-RA (CG13337), mRNA 
0   NM_166385.2  CG8908-RA, transcript variant A (CG8908), mRNA 
0   NM_137620.2  CG8908-RB, transcript variant B (CG8908), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.