National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31369R-3 
 Symbol PQBP-1  Full Name Poly-glutamine tract binding protein 1 
 CG No CG31369  Old CG No CG31369 
 Synonyms CG31369, CG31264, CG11731, CT32186, BcDNA:AT05815, CG11730, CG11729, CG11733, PQBP-1, dPQBP-1, dPQBP1 
 Accession No (Link to NCBI) NM_169223.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCAAAAGGAGCAGCAGGA 
 Primer Seq. 3'
aatctagaggtaccTGGCGCCACACGTACGACAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCAAAAG GAGCAGCAGG AGCAGGAGTA GCATCAGCAC CAGCATCAGC AGCAGCGGGA 
0061 GCAGCACCAA GATTGCCCAA CTATTGCTCC TTATCGGCAT CGCAGTCGCA TCTTGTTTGC 
0121 CGGGATCCGA GGGATTTCAG CGATTCTCGG AGCAGCCCAA GTACACGGAG GTGAATCCCG 
0181 CCGAGGACAC GCTGCTCACA TGCAAAGTAA TCGACAAGCG CGGCACGTGC TCCTGGCAAA 
0241 AGGATAACAA GCCCGTTGGC ATCTATACAA AGAAATACGA ATGGGCCTCA CGTATGCCGA 
0301 CAAGCGACAA TGGAAATGTC CTGCATCTGG ATCTCCATNC CGCCGCCGGT GCAGCTCGGT 
0361 GGCGACTGCT CCCTCTGGAT CCGCTCCGCC ACACTGGACT TTGACGACGG ACTATGGGAG 
0421 TGCCAAGTGA CGGCCAGTGA CTTCACCACG CAGGATGCCC TCACCAGCCA GCCGGTGCGC 
0481 NCTTGTCGTA CGTGTGGCGC CA 
 in silico PCR Fragment
0001 GGAGCAAAAG GAGCAGCAGG AGCAGGAGTA GCATCAGCAC CAGCATCAGC AGCAGCGGGA 
0061 GCAGCACCAA GATTGCCCAA CTATTGCTCC TTATCGGCAT CGCAGTCGCA TCTTGTTTGC 
0121 CGGGATCCGA GGGATTTCAG CGATTCTCGG AGCAGCCCAA GTACACGGAG GTGAATCCCG 
0181 CCGAGGACAC GCTGCTCACA TGCAAAGTAA TCGACAAGCG CGGCACGTGC TCCTGGCAAA 
0241 AGGATAACAA GCCCGTTGGC ATCTATACAA AGAAATACGA ATGGGCCTCA CGTATGCCGA 
0301 CAAGCGACAA TGGAAATGTC CTGCATCTGG ATCTCCAT-C CGCCGCCGGT GCAGCTCGGT 
0361 GGCGACTGCT CCCTCTGGAT CCGCTCCGCC ACACTGGACT TTGACGACGG ACTATGGGAG 
0421 TGCCAAGTGA CGGCCAGTGA CTTCACCACG CAGGATGCCC TCACCAGCCA GCCGGTGCGG 
0481 -CTTGTCGTA CGTGTGGCGC CA 
 Assemble Data

31369R-3.IR_full       1   GGAGCAAAAGGAGCAGCAGGAGCAGGAGTAGCATCAGCACCAGCATCAGCAGCAGCGGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     1   GGAGCAAAAGGAGCAGCAGGAGCAGGAGTAGCATCAGCACCAGCATCAGCAGCAGCGGGA 60


31369R-3.IR_full       61  GCAGCACCAAGATTGCCCAACTATTGCTCCTTATCGGCATCGCAGTCGCATCTTGTTTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     61  GCAGCACCAAGATTGCCCAACTATTGCTCCTTATCGGCATCGCAGTCGCATCTTGTTTGC 120


31369R-3.IR_full       121 CGGGATCCGAGGGATTTCAGCGATTCTCGGAGCAGCCCAAGTACACGGAGGTGAATCCCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     121 CGGGATCCGAGGGATTTCAGCGATTCTCGGAGCAGCCCAAGTACACGGAGGTGAATCCCG 180


31369R-3.IR_full       181 CCGAGGACACGCTGCTCACATGCAAAGTAATCGACAAGCGCGGCACGTGCTCCTGGCAAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     181 CCGAGGACACGCTGCTCACATGCAAAGTAATCGACAAGCGCGGCACGTGCTCCTGGCAAA 240


31369R-3.IR_full       241 AGGATAACAAGCCCGTTGGCATCTATACAAAGAAATACGAATGGGCCTCACGTATGCCGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     241 AGGATAACAAGCCCGTTGGCATCTATACAAAGAAATACGAATGGGCCTCACGTATGCCGA 300


31369R-3.IR_full       301 CAAGCGACAATGGAAATGTCCTGCATCTGGATCTCCATNCCGCCGCCGGTGCAGCTCGGT 360
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
31369R-3.in silico     301 CAAGCGACAATGGAAATGTCCTGCATCTGGATCTCCAT-CCGCCGCCGGTGCAGCTCGGT 360


31369R-3.IR_full       361 GGCGACTGCTCCCTCTGGATCCGCTCCGCCACACTGGACTTTGACGACGGACTATGGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31369R-3.in silico     361 GGCGACTGCTCCCTCTGGATCCGCTCCGCCACACTGGACTTTGACGACGGACTATGGGAG 420


31369R-3.IR_full       421 TGCCAAGTGACGGCCAGTGACTTCACCACGCAGGATGCCCTCACCAGCCAGCCGGTGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
31369R-3.in silico     421 TGCCAAGTGACGGCCAGTGACTTCACCACGCAGGATGCCCTCACCAGCCAGCCGGTGCGG 480


31369R-3.IR_full        481 CTTGTCGTACGTGTGGCGCCA 501
                            |||||||||||||||||||||
31369R-3.in silico      481 CTTGTCGTACGTGTGGCGCCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  66  NM_169223.2  CG31369-RA (PQBP-1), mRNA 
1.65   61  300  NM_078797.2  CG13109-RA (tai), mRNA 
1.45   10  108  NM_176758.1  CG6500-RC, transcript variant C (Bx), mRNA 
1.45   10  108  NM_167625.1  CG6500-RA, transcript variant A (Bx), mRNA 
1.45   10  103  NM_078678.2  CG6500-RB, transcript variant B (Bx), mRNA 
0.82   17  31  141  NM_164727.1  CG31908-RB, transcript variant B (CG31908), mRNA 
0.82   17  31  141  NM_164726.1  CG31908-RA, transcript variant A (CG31908), mRNA 
0.82   10  15  42  NM_130635.2  CG3078-RA (CG3078), mRNA 
0.82   43  262  NM_132413.1  CG15295-RA (CG15295), mRNA 
0.62   NM_130577.2  CG3095-RA (hfw), mRNA 
0.62   11  NM_001032249.1  CG30084-RF, transcript variant F (CG30084), mRNA 
0.41   13  34  103  NM_142710.2  CG16791-RA (CG16791), mRNA 
0.41   20  90  NM_143310.2  CG12885-RA (CG12885), mRNA 
0.41   NM_144232.1  CG15911-RA (CG15911), mRNA 
0.41   11  NM_130639.2  CG2918-RA (CG2918), mRNA 
0.2   25  70  338  NM_132665.1  CG15753-RA (CG15753), mRNA 
0.2   13  26  119  NM_078509.2  CG3929-RA (dx), mRNA 
0.2   23  134  NM_079322.2  CG10605-RA (caup), mRNA 
0.2   47  214  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.2   47  213  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.2   10  NM_132460.2  CG18292-RA (CG18292), mRNA 
0.2   10  37  NM_134718.4  CG31795-RA, transcript variant A (ia2), mRNA 
0.2   10  36  NM_164401.3  CG31795-RB, transcript variant B (ia2), mRNA 
0   14  12  56  NM_136028.2  CG7180-RA (CG7180), mRNA 
0   13  59  277  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0   13  59  277  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0   12  32  169  NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
0   12  32  169  NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
0   11  128  627  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   10  12  62  NM_141542.1  CG11718-RA (CG11718), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.