National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31361R-2 
 Symbol dpr17  Full Name dpr17 
 CG No CG31361  Old CG No CG31361 
 Synonyms CG31361, Dpr-17, CG14738, CT34531, CG14737, dpr17 
 Accession No (Link to NCBI) NM_169451.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGGAGGCAGGCGGACAATGA 
 Primer Seq. 3'
aatctagaggtaccTTGCTGTCGCTAAGTTGCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGGAGGCAG GCGGACAATG AGCGCACAAA AGGCGCTGTA AGTGTCATTG CAGCCAGGAA 
0061 CTGGGCCACT GGGACTGCCA CGCAGGACTG GAGCCAGAAG AGCAGCAGTA GCTGGAGCAG 
0121 CACCAGTCGA AGAACCGGAA TCAGCAGAAC CAGGACCAGG CCAGCCACGT TGACAACCGA 
0181 GATGACAGTG GCAGGACGAG CAGAACGAGC AGGAGTAGGA GCGCCGTGGT GTCGCCGATT 
0241 TTTCCATACA TCCCCACTAG CGTCTTGGCT ACGCATCAGC TTCGTCCTTT TGGTCCTTCC 
0301 AGCTCTCGGC TTTGGGATAC AAGTAGTCAC CTGCAGCAAT CCGGAACTAG GAGCAAGTGC 
0361 TCCAGATCCA GTGGATTTAA CATGGGGAGG GAAAAACACT GAGGGACAGC TTACGACGGC 
0421 CACAAGATCC ACTCTGCCAG ATAGTCCAAT GACAACACAA AACGATCTAA TTACGACAGC 
0481 CAGCAACTTA GCGACAAAGG CAA 
 in silico PCR Fragment
0001 TTGGAGGCAG GCGGACAATG AGCGCACAAA AGGCGCTGTA AGTGTCATTG CAGCCAGGAA 
0061 CTGGGCCACT GGGACTGCCA CGCAGGACTG GAGCCAGAAG AGCAGCAGTA GCTGGAGCAG 
0121 CACCAGTCGA AGAACCGGAA TCAGCAGAAC CAGGACCAGG CCAGCCACGT TGACAACCGA 
0181 GATGACAGTG GCAGGACGAG CAGAACGAGC AGGAGTAGGA GCGCCGTGGT GTCGCCGATT 
0241 TTTCCATACA TCCCCACTAG CGTCTTGGCT ACGCATCAGC TTCGTCCTTT TGGTCCTTCC 
0301 AGCTCTCGGC TTTGGGATAC AAGTAGTCAC CTGCAGCAAT CCGGAACTAG GAGCAAGTGC 
0361 TCCAGATCCA GTGGATTTAA CATGGGGAGG GAAAAACACT GAGGGACAGC TTACGACGGC 
0421 CACAAGATCC ACTCTGCCAG ATAGTCCAAT GACAACACAA AACGATCTAA TTACGACAGC 
0481 CAGCAACTTA GCGACA---G CAA 
 Assemble Data

31361R-2.IR_full       1   TTGGAGGCAGGCGGACAATGAGCGCACAAAAGGCGCTGTAAGTGTCATTGCAGCCAGGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     1   TTGGAGGCAGGCGGACAATGAGCGCACAAAAGGCGCTGTAAGTGTCATTGCAGCCAGGAA 60


31361R-2.IR_full       61  CTGGGCCACTGGGACTGCCACGCAGGACTGGAGCCAGAAGAGCAGCAGTAGCTGGAGCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     61  CTGGGCCACTGGGACTGCCACGCAGGACTGGAGCCAGAAGAGCAGCAGTAGCTGGAGCAG 120


31361R-2.IR_full       121 CACCAGTCGAAGAACCGGAATCAGCAGAACCAGGACCAGGCCAGCCACGTTGACAACCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     121 CACCAGTCGAAGAACCGGAATCAGCAGAACCAGGACCAGGCCAGCCACGTTGACAACCGA 180


31361R-2.IR_full       181 GATGACAGTGGCAGGACGAGCAGAACGAGCAGGAGTAGGAGCGCCGTGGTGTCGCCGATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     181 GATGACAGTGGCAGGACGAGCAGAACGAGCAGGAGTAGGAGCGCCGTGGTGTCGCCGATT 240


31361R-2.IR_full       241 TTTCCATACATCCCCACTAGCGTCTTGGCTACGCATCAGCTTCGTCCTTTTGGTCCTTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     241 TTTCCATACATCCCCACTAGCGTCTTGGCTACGCATCAGCTTCGTCCTTTTGGTCCTTCC 300


31361R-2.IR_full       301 AGCTCTCGGCTTTGGGATACAAGTAGTCACCTGCAGCAATCCGGAACTAGGAGCAAGTGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     301 AGCTCTCGGCTTTGGGATACAAGTAGTCACCTGCAGCAATCCGGAACTAGGAGCAAGTGC 360


31361R-2.IR_full       361 TCCAGATCCAGTGGATTTAACATGGGGAGGGAAAAACACTGAGGGACAGCTTACGACGGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     361 TCCAGATCCAGTGGATTTAACATGGGGAGGGAAAAACACTGAGGGACAGCTTACGACGGC 420


31361R-2.IR_full       421 CACAAGATCCACTCTGCCAGATAGTCCAATGACAACACAAAACGATCTAATTACGACAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31361R-2.in silico     421 CACAAGATCCACTCTGCCAGATAGTCCAATGACAACACAAAACGATCTAATTACGACAGC 480


31361R-2.IR_full       481 CAGCAACTTAGCGACAAAGGCAA 503
                           ||||||||||||||||   ||||
31361R-2.in silico     481 CAGCAACTTAGCGACA---GCAA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  19  NM_169451.1  CG31361-RA, transcript variant A (dpr17), mRNA 
33.6   162  16  NM_169452.1  CG31361-RB, transcript variant B (dpr17), mRNA 
0.62   NM_143387.1  CG14523-RA (CG14523), mRNA 
0   NM_167449.1  CG6340-RD, transcript variant D (CG6340), mRNA 
0   NM_132806.2  CG6340-RB, transcript variant B (CG6340), mRNA 
0   NM_135884.2  CG15278-RA (CG15278), mRNA 
0   10  NM_141831.1  CG5342-RA (CG5342), mRNA 
0   NM_169182.1  CG31496-RA (CG31496), mRNA 
0   NM_142104.1  CG14847-RA (CG14847), mRNA 
0   NM_137311.2  CG8566-RD (unc-104), mRNA 
0   NM_139924.3  CG7476-RA, transcript variant A (mthl7), mRNA 
0   NM_176297.1  CG7476-RB, transcript variant B (mthl7), mRNA 
0   NM_057961.4  CG3771-RA (a6), mRNA 
0   NM_078688.2  CG14226-RA (dome), mRNA 
0   NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0   NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0   NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0   NM_143362.2  CG14064-RA (beat-VI), mRNA 
0   NM_079952.2  CG8205-RD, transcript variant D (fus), mRNA 
0   NM_166109.1  CG8205-RB, transcript variant B (fus), mRNA 
0   NM_166108.1  CG8205-RF, transcript variant F (fus), mRNA 
0   NM_166107.1  CG8205-RE, transcript variant E (fus), mRNA 
0   NM_080142.2  CG1925-RA (mus205), mRNA 
0   NM_135454.4  CG3838-RB, transcript variant B (CG3838), mRNA 
0   NM_001032023.1  CG11779-RC, transcript variant C (CG11779), mRNA 
0   NM_142528.2  CG5835-RA (CG5835), mRNA 
0   NM_139499.2  CG2107-RA (CG2107), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_080535.2  CG9774-RA (rok), mRNA 
0   NM_142225.2  CG5404-RA (CG5404), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.