National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31298R-3 
 Symbol beat-Vb  Full Name beat-Vb 
 CG No CG31298  Old CG No CG31298 
 Synonyms beat Vb, CG14386, CG14385, CG31298, beat-Vb 
 Accession No (Link to NCBI) NM_169481.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTTAGATACTCGCCCCTCAC 
 Primer Seq. 3'
aatctagaggtaccTCCGCTTTTGCTGGATCAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTTAGATAC TCGCCCCTCA CCCCGCCCAC CTACATTCCG TTCGCCGTTG AGGGCGTGCA 
0061 GCTGATCGAT GACGGCAACG AGTGCAACGA ATCCTCCTGT CGCGTGGAGC TCAATTTATT 
0121 GGGCGTCAAG TCGTCGGGCG TCTACAGGTG CGAAGTGTCC GGCGATGCTC CCCACTTCCA 
0181 GCTAACTGCA CGCGATGCCA ACATGACCGT CGAAGCACTT CCCCAAAACA ATCCACTCAT 
0241 CAGCAGCTTT CACTCAACTT ATCGCTTTAA TGACTTCGTA GAGGTCAACT GTAGTACAGA 
0301 TTTCTCCAGC CTTTTCACAC GGATTACCTG GTACGTCAAT GGGATAAAGG TTTCTCTGGT 
0361 GGATCTACTA CCCTCTTTTG AGACCACCAT AGTAGCCCAT GGATACAGCA TGCGACGCAT 
0421 TGTTTCCCAG CTCAATTTCT ACGCCAATGA ACCACGTTTC CATCAATTGC AATTGCAAAA 
0481 ACTGATCCAG CAAAAGCGGG  
 in silico PCR Fragment
0001 TTTTAGATAC TCGCCCCTCA CCCCGCCCAC CTACATTCCG TTCGCCGTTG AGGGCGTGCA 
0061 GCTGATCGAT GACGGCAACG AGTGCAACGA ATCCTCCTGT CGCGTGGAGC TCAATTTATT 
0121 GGGCGTCAAG TCGTCGGGCG TCTACAGGTG CGAAGTGTCC GGTGACGCTC CCCACTTCCA 
0181 GCTAACTGCA CGCGATGCCA ACATGACCGT CGAAGCACTT CCCCAAAACA ATCCACTCAT 
0241 CAGCAGCTTT CACTCAACTT ATCGCTTTAA TGACTTCGTA GAGGTCAACT GTAGTACAGA 
0301 TTTCTCCAGC CTTTTCACAC GGATTACCTG GTACGTCAAT GGGATAAAGG TTTCTCTGGT 
0361 GGATCTACTA CCCTCTTTTG AGACCACCAT AGTAGCCCAT GGATACAGCA TGCGACGCAT 
0421 TGTTTCCCAG CTCAATTTCT ACGCCAATGA ACCACGTTTC CATCAATTGC AATTGCAAAA 
0481 ACTGATCCAG CAAAAGCGGA  
 Assemble Data

31298R-3.IR_full       1   TTTTAGATACTCGCCCCTCACCCCGCCCACCTACATTCCGTTCGCCGTTGAGGGCGTGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     1   TTTTAGATACTCGCCCCTCACCCCGCCCACCTACATTCCGTTCGCCGTTGAGGGCGTGCA 60


31298R-3.IR_full       61  GCTGATCGATGACGGCAACGAGTGCAACGAATCCTCCTGTCGCGTGGAGCTCAATTTATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     61  GCTGATCGATGACGGCAACGAGTGCAACGAATCCTCCTGTCGCGTGGAGCTCAATTTATT 120


31298R-3.IR_full       121 GGGCGTCAAGTCGTCGGGCGTCTACAGGTGCGAAGTGTCCGGCGATGCTCCCCACTTCCA 180
                           |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||
31298R-3.in silico     121 GGGCGTCAAGTCGTCGGGCGTCTACAGGTGCGAAGTGTCCGGTGACGCTCCCCACTTCCA 180


31298R-3.IR_full       181 GCTAACTGCACGCGATGCCAACATGACCGTCGAAGCACTTCCCCAAAACAATCCACTCAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     181 GCTAACTGCACGCGATGCCAACATGACCGTCGAAGCACTTCCCCAAAACAATCCACTCAT 240


31298R-3.IR_full       241 CAGCAGCTTTCACTCAACTTATCGCTTTAATGACTTCGTAGAGGTCAACTGTAGTACAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     241 CAGCAGCTTTCACTCAACTTATCGCTTTAATGACTTCGTAGAGGTCAACTGTAGTACAGA 300


31298R-3.IR_full       301 TTTCTCCAGCCTTTTCACACGGATTACCTGGTACGTCAATGGGATAAAGGTTTCTCTGGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     301 TTTCTCCAGCCTTTTCACACGGATTACCTGGTACGTCAATGGGATAAAGGTTTCTCTGGT 360


31298R-3.IR_full       361 GGATCTACTACCCTCTTTTGAGACCACCATAGTAGCCCATGGATACAGCATGCGACGCAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     361 GGATCTACTACCCTCTTTTGAGACCACCATAGTAGCCCATGGATACAGCATGCGACGCAT 420


31298R-3.IR_full       421 TGTTTCCCAGCTCAATTTCTACGCCAATGAACCACGTTTCCATCAATTGCAATTGCAAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31298R-3.in silico     421 TGTTTCCCAGCTCAATTTCTACGCCAATGAACCACGTTTCCATCAATTGCAATTGCAAAA 480


31298R-3.IR_full       481 ACTGATCCAGCAAAAGCGGG 500
                           ||||||||||||||||||| 
31298R-3.in silico     481 ACTGATCCAGCAAAAGCGGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169481.1  CG31298-RA (beat-Vb), mRNA 
0.2   NM_170557.1  CG11525-RD, transcript variant D (CycG), mRNA 
0.2   NM_170555.1  CG11525-RB, transcript variant B (CycG), mRNA 
0.2   NM_079870.2  CG11525-RA, transcript variant A (CycG), mRNA 
0.2   NM_170558.1  CG11525-RE, transcript variant E (CycG), mRNA 
0.2   NM_170556.1  CG11525-RC, transcript variant C (CycG), mRNA 
0   NM_136225.2  CG9336-RA (CG9336), mRNA 
0   13  NM_141973.1  CG14390-RA (beat-Vc), mRNA 
0   NM_078612.2  CG8470-RA (mRpS30), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_167114.2  CG18350-RH, transcript variant H (Sxl), mRNA 
0   NM_001031893.1  CG18350-RM, transcript variant M (Sxl), mRNA 
0   NM_001031891.1  CG18350-RO, transcript variant O (Sxl), mRNA 
0   NM_001031890.1  CG14425-RA, transcript variant A (CG14425), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_206766.1  CG9699-RG, transcript variant G (CG9699), mRNA 
0   NM_132919.2  CG9699-RC, transcript variant C (CG9699), mRNA 
0   NM_167531.1  CG9699-RB, transcript variant B (CG9699), mRNA 
0   NM_167533.1  CG9699-RE, transcript variant E (CG9699), mRNA 
0   NM_167532.1  CG9699-RD, transcript variant D (CG9699), mRNA 
0   NM_167534.1  CG9699-RF, transcript variant F (CG9699), mRNA 
0   NM_167530.1  CG9699-RA, transcript variant A (CG9699), mRNA 
0   NM_001015347.1  CG40084-PD.3 (CG40084), mRNA 
0   NM_001015346.1  CG40084-PC.3 (CG40084), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_136477.2  CG30497-RA, transcript variant A (CG30497), mRNA 
0   NM_165555.1  CG30497-RB, transcript variant B (CG30497), mRNA 
0   NM_165556.1  CG30497-RC, transcript variant C (CG30497), mRNA 
0   NM_136444.2  CG12736-RA (CG12736), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.