National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31298R-1 
 Symbol beat-Vb  Full Name beat-Vb 
 CG No CG31298  Old CG No CG31298 
 Synonyms beat Vb, CG14386, CG14385, CG31298, beat-Vb 
 Accession No (Link to NCBI) NM_169481.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTTAGATACTCGCCCCTCACCCCGCCCACCTACATTCCGTTCGCCGTTGAGGGCGTGCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCTGATCGATGACGGCAACGAGTGCAACGAATCCTCCTGTCGCGTGGAGCTCAATTTATT 120

                           |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| silico     121 GGGCGTCAAGTCGTCGGGCGTCTACAGGTGCGAAGTGTCCGGTGACGCTCCCCACTTCCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTAACTGCACGCGATGCCAACATGACCGTCGAAGCACTTCCCCAAAACAATCCACTCAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CAGCAGCTTTCACTCAACTTATCGCTTTAATGACTTCGTAGAGGTCAACTGTAGTACAGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTTCTCCAGCCTTTTCACACGGATTACCTGGTACGTCAATGGGATAAAGGTTTCTCTGGT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGATCTACTACCCTCTTTTGAGACCACCATAGTAGCCCATGGATACAGCATGCGACGCAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTTTCCCAGCTCAATTTCTACGCCAATGAACCACGTTTCCATCAATTGCAATTGCAAAA 480

31298R-1.IR_full       481 ACTGATCCAGCAAAAGCGGG 500
                           ||||||||||||||||||| silico     481 ACTGATCCAGCAAAAGCGGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169481.1  CG31298-RA (beat-Vb), mRNA 
0.2   NM_170557.1  CG11525-RD, transcript variant D (CycG), mRNA 
0.2   NM_170555.1  CG11525-RB, transcript variant B (CycG), mRNA 
0.2   NM_079870.2  CG11525-RA, transcript variant A (CycG), mRNA 
0.2   NM_170558.1  CG11525-RE, transcript variant E (CycG), mRNA 
0.2   NM_170556.1  CG11525-RC, transcript variant C (CycG), mRNA 
0   NM_136225.2  CG9336-RA (CG9336), mRNA 
0   13  NM_141973.1  CG14390-RA (beat-Vc), mRNA 
0   NM_078612.2  CG8470-RA (mRpS30), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_167114.2  CG18350-RH, transcript variant H (Sxl), mRNA 
0   NM_001031893.1  CG18350-RM, transcript variant M (Sxl), mRNA 
0   NM_001031891.1  CG18350-RO, transcript variant O (Sxl), mRNA 
0   NM_001031890.1  CG14425-RA, transcript variant A (CG14425), mRNA 
0   NM_057638.3  CG14472-RA (poe), mRNA 
0   NM_206766.1  CG9699-RG, transcript variant G (CG9699), mRNA 
0   NM_132919.2  CG9699-RC, transcript variant C (CG9699), mRNA 
0   NM_167531.1  CG9699-RB, transcript variant B (CG9699), mRNA 
0   NM_167533.1  CG9699-RE, transcript variant E (CG9699), mRNA 
0   NM_167532.1  CG9699-RD, transcript variant D (CG9699), mRNA 
0   NM_167534.1  CG9699-RF, transcript variant F (CG9699), mRNA 
0   NM_167530.1  CG9699-RA, transcript variant A (CG9699), mRNA 
0   NM_001015347.1  CG40084-PD.3 (CG40084), mRNA 
0   NM_001015346.1  CG40084-PC.3 (CG40084), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_136477.2  CG30497-RA, transcript variant A (CG30497), mRNA 
0   NM_165555.1  CG30497-RB, transcript variant B (CG30497), mRNA 
0   NM_165556.1  CG30497-RC, transcript variant C (CG30497), mRNA 
0   NM_136444.2  CG12736-RA (CG12736), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.