National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3114R-2 
 Symbol ewg  Full Name erect wing 
 CG No CG3114  Old CG No CG3114 
 Synonyms EWG, EG:BACR37P7.7, CG3114, l(1)1Ag, l(1)DA659, EC3, l[EC3], l(1)EC3, NRF-1, l(1)VA720, l(1)EC3f, ewg 
 Accession No (Link to NCBI) NM_166836.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTGGGTTCCATGCCAGTG 
 Primer Seq. 3'
aatctagaggtaccCCTCGTCCCGTAGAATACTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCTGGGTT CCATGCCAGT GAATGATGAT GTGGCCCACC AACTAGCGGC CGCAGGACCA 
0061 GTAGGCGTGG CAGCAGCGGC AGCAATAGCG AGTTCTAAAA AGCGAAAGAG ACCCCATTGT 
0121 TTCGAAACGA ATCCCTCGGT TAGAAAAAGG CAACAAAATC GATTGTTGCG CAAGCTGAGA 
0181 GCTATTATCT ATGAGTTTAC GGGCAGAGTG GGCAAACAAG CGGTAGTTTT GGTGGCAACA 
0241 CCGGGTAAAC CCAACACAAG CTATAAGGTT TTTGGAGCCA AACCCCTGGA AGATGTGTTG 
0301 CGCAACCTAA AAAACATTGT AATGGATGAA CTGGACAATG CACTGGCCCA GCAAGCTCCC 
0361 CCTCCGCCCC AAGATGATCC ATCGCTCTTC GAACTTCCTG GCTTGGTAAT CGATGGTATT 
0421 CCCACTCCCG TAGAAAAGAT GACCCAAGCG CAGCTAAGAG CCTTTATTCC GCTGATGCTC 
0481 AAGTATTCTA CGGGACGAGG  
 in silico PCR Fragment
0001 GATCTGGGTT CCATGCCAGT GAATGATGAT GTGGCCCACC AACTAGCGGC CGCAGGACCA 
0061 GTAGGCGTGG CAGCAGCGGC AGCAATAGCG AGTTCTAAAA AGCGAAAGAG ACCCCATTGT 
0121 TTCGAAACGA ATCCCTCGGT TAGAAAAAGG CAACAAAATC GATTGTTGCG CAAGCTGAGA 
0181 GCTATTATCT ATGAGTTTAC GGGCAGAGTG GGCAAACAAG CGGTAGTTTT GGTGGCAACA 
0241 CCGGGTAAAC CCAACACAAG CTATAAGGTT TTTGGAGCCA AACCCCTGGA AGATGTGTTG 
0301 CGCAACCTAA AAAACATTGT AATGGATGAA CTGGACAATG CACTGGCCCA GCAAGCTCCC 
0361 CCTCCGCCCC AAGATGATCC ATCGCTCTTC GAACTTCCTG GCTTGGTAAT CGATGGTATT 
0421 CCCACTCCCG TAGAAAAGAT GACCCAAGCG CAGCTAAGAG CCTTTATTCC GCTGATGCTC 
0481 AAGTATTCTA CGGGACGAGG  
 Assemble Data

3114R-2.IR_full       1   GATCTGGGTTCCATGCCAGTGAATGATGATGTGGCCCACCAACTAGCGGCCGCAGGACCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     1   GATCTGGGTTCCATGCCAGTGAATGATGATGTGGCCCACCAACTAGCGGCCGCAGGACCA 60


3114R-2.IR_full       61  GTAGGCGTGGCAGCAGCGGCAGCAATAGCGAGTTCTAAAAAGCGAAAGAGACCCCATTGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     61  GTAGGCGTGGCAGCAGCGGCAGCAATAGCGAGTTCTAAAAAGCGAAAGAGACCCCATTGT 120


3114R-2.IR_full       121 TTCGAAACGAATCCCTCGGTTAGAAAAAGGCAACAAAATCGATTGTTGCGCAAGCTGAGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     121 TTCGAAACGAATCCCTCGGTTAGAAAAAGGCAACAAAATCGATTGTTGCGCAAGCTGAGA 180


3114R-2.IR_full       181 GCTATTATCTATGAGTTTACGGGCAGAGTGGGCAAACAAGCGGTAGTTTTGGTGGCAACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     181 GCTATTATCTATGAGTTTACGGGCAGAGTGGGCAAACAAGCGGTAGTTTTGGTGGCAACA 240


3114R-2.IR_full       241 CCGGGTAAACCCAACACAAGCTATAAGGTTTTTGGAGCCAAACCCCTGGAAGATGTGTTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     241 CCGGGTAAACCCAACACAAGCTATAAGGTTTTTGGAGCCAAACCCCTGGAAGATGTGTTG 300


3114R-2.IR_full       301 CGCAACCTAAAAAACATTGTAATGGATGAACTGGACAATGCACTGGCCCAGCAAGCTCCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     301 CGCAACCTAAAAAACATTGTAATGGATGAACTGGACAATGCACTGGCCCAGCAAGCTCCC 360


3114R-2.IR_full       361 CCTCCGCCCCAAGATGATCCATCGCTCTTCGAACTTCCTGGCTTGGTAATCGATGGTATT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     361 CCTCCGCCCCAAGATGATCCATCGCTCTTCGAACTTCCTGGCTTGGTAATCGATGGTATT 420


3114R-2.IR_full       421 CCCACTCCCGTAGAAAAGATGACCCAAGCGCAGCTAAGAGCCTTTATTCCGCTGATGCTC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3114R-2.in silico     421 CCCACTCCCGTAGAAAAGATGACCCAAGCGCAGCTAAGAGCCTTTATTCCGCTGATGCTC 480


3114R-2.IR_full       481 AAGTATTCTACGGGACGAGG 500
                          ||||||||||||||||||||
3114R-2.in silico     481 AAGTATTCTACGGGACGAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166836.1  CG3114-RA, transcript variant A (ewg), mRNA 
100   482  NM_057544.3  CG3114-RB, transcript variant B (ewg), mRNA 
100   482  NM_001014708.1  CG3114-RF, transcript variant F (ewg), mRNA 
100   482  NM_001014707.1  CG3114-RG, transcript variant G (ewg), mRNA 
100   482  NM_001014712.1  CG3114-RH, transcript variant H (ewg), mRNA 
100   482  NM_001014711.1  CG3114-RC, transcript variant C (ewg), mRNA 
100   482  NM_001014709.1  CG3114-RE, transcript variant E (ewg), mRNA 
100   482  NM_001014710.1  CG3114-RD, transcript variant D (ewg), mRNA 
0.41   13  NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0   20  NM_134527.1  CG15322-RA (CG15322), mRNA 
0   15  NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   32  NM_078514.2  CG9653-RA (brk), mRNA 
0   32  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   10  NM_137564.2  CG7417-RA (Tab2), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_165005.1  CG31762-RD, transcript variant D (aret), mRNA 
0   NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_165003.1  CG31762-RC, transcript variant C (aret), mRNA 
0   NM_165004.1  CG31762-RA, transcript variant A (aret), mRNA 
0   19  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0   16  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_143144.2  CG5107-RA (CG5107), mRNA 
0   NM_168816.1  CG8522-RB, transcript variant B (HLH106), mRNA 
0   NM_168815.1  CG8522-RA, transcript variant A (HLH106), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 
0   NM_142768.3  CG7073-RB, transcript variant B (sar1), mRNA 
0   26  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0   26  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0   41  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.