National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3114R-1 
 Symbol ewg  Full Name erect wing 
 CG No CG3114  Old CG No CG3114 
 Synonyms EWG, EG:BACR37P7.7, CG3114, l(1)1Ag, l(1)DA659, EC3, l[EC3], l(1)EC3, NRF-1, l(1)VA720, l(1)EC3f, ewg 
 Accession No (Link to NCBI) NM_166836.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GATCTGGGTTCCATGCCAGTGAATGATGATGTGGCCCACCAACTAGCGGCCGCAGGACCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTAGGCGTGGCAGCAGCGGCAGCAATAGCGAGTTCTAAAAAGCGAAAGAGACCCCATTGT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCGAAACGAATCCCTCGGTTAGAAAAAGGCAACAAAATCGATTGTTGCGCAAGCTGAGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTATTATCTATGAGTTTACGGGCAGAGTGGGCAAACAAGCGGTAGTTTTGGTGGCAACA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGGGTAAACCCAACACAAGCTATAAGGTTTTTGGAGCCAAACCCCTGGAAGATGTGTTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCAACCTAAAAAACATTGTAATGGATGAACTGGACAATGCACTGGCCCAGCAAGCTCCC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCTCCGCCCCAAGATGATCCATCGCTCTTCGAACTTCCTGGCTTGGTAATCGATGGTATT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCCACTCCCGTAGAAAAGATGACCCAAGCGCAGCTAAGAGCCTTTATTCCGCTGATGCTC 480

3114R-1.IR_full       481 AAGTATTCTACGGGACGAGG 500
                          |||||||||||||||||||| silico     481 AAGTATTCTACGGGACGAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_166836.1  CG3114-RA, transcript variant A (ewg), mRNA 
100   482  NM_057544.3  CG3114-RB, transcript variant B (ewg), mRNA 
100   482  NM_001014708.1  CG3114-RF, transcript variant F (ewg), mRNA 
100   482  NM_001014707.1  CG3114-RG, transcript variant G (ewg), mRNA 
100   482  NM_001014712.1  CG3114-RH, transcript variant H (ewg), mRNA 
100   482  NM_001014711.1  CG3114-RC, transcript variant C (ewg), mRNA 
100   482  NM_001014709.1  CG3114-RE, transcript variant E (ewg), mRNA 
100   482  NM_001014710.1  CG3114-RD, transcript variant D (ewg), mRNA 
0.41   13  NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0   20  NM_134527.1  CG15322-RA (CG15322), mRNA 
0   15  NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   32  NM_078514.2  CG9653-RA (brk), mRNA 
0   32  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0   10  NM_137564.2  CG7417-RA (Tab2), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_165005.1  CG31762-RD, transcript variant D (aret), mRNA 
0   NM_165002.1  CG31762-RB, transcript variant B (aret), mRNA 
0   NM_165003.1  CG31762-RC, transcript variant C (aret), mRNA 
0   NM_165004.1  CG31762-RA, transcript variant A (aret), mRNA 
0   19  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0   16  NM_140792.1  CG6896-RA (MYPT-75D), mRNA 
0   NM_143144.2  CG5107-RA (CG5107), mRNA 
0   NM_168816.1  CG8522-RB, transcript variant B (HLH106), mRNA 
0   NM_168815.1  CG8522-RA, transcript variant A (HLH106), mRNA 
0   NM_079442.2  CG8522-RC, transcript variant C (HLH106), mRNA 
0   NM_142768.3  CG7073-RB, transcript variant B (sar1), mRNA 
0   26  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
0   26  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
0   41  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.