National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31044R-2 
 Symbol CG31044  Full Name CG31044 
 CG No CG31044  Old CG No CG31044 
 Synonyms BcDNA:SD09455, CG31044 
 Accession No (Link to NCBI) NM_170400.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval/pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCGGAACACCTTTCAACCCC 
 Primer Seq. 3'
aatctagaggtaccTAGTTGCGGCGTTTGACGGCT 
 Predicted Fragment Size
413 
 IR fragment full Seq
0001 GCCGGAACAC CTTTCAACCC CGTGGGCCAT TGTTAGTGCT CCGTGGCTAG GGATAGATGG 
0061 CTACTGTATG GCCACTTGCT GCACGGCCAT GAAGCTACTC CTCCCACACG ATTTGCTTCA 
0121 CGCTCATTTA AATGCCAACG CACCGGAGGG AGGAGAGAGC AGGGCACTTC ACTTCGGCGG 
0181 CTCGGCTGGC TTATTTACAT ATTTTCTAAA TGAATATGGG CCCCGCGAGT TTGCAACCCC 
0241 GACCGGCGGT GGCAAAGCCG AGAAGCGCAT TCAGTTGCAA CGGCCGCGGC AGCTGGCTTT 
0301 CCCTGCACTG GATTTCCACT TCCTCCTGGT CGAAGCAGCC GCAGCAGCAG CAGCAATAAC 
0361 AATCAGGAAC AGCAGCAGCA GCAGCAACAA GAAGCCGTCA AACGCCGCAA CTA 
 in silico PCR Fragment
0001 GCCGGAACAC CTTTCAACCC CGTGGGCCAT TGTTAGTGCT CCGTGGCTAG GGATAGATGG 
0061 CTACTGTATG GCCACTTGCT GCACGGCCAT GAAGCTACTC CTCCCACACG ATTTGCTTCA 
0121 CGCTCATTTA AATGCCAACG CACCGCAGGG AGGAGAGAGC AGGGCACTTC ACTTCGGCGG 
0181 CTCGGCTGGC TTATTTACAT ATTTTCTAAA TGAATATGGG CCCCGCGAGT TTGCAACCCC 
0241 GACCGGCGGT GGCAAAGCCG AGAAGCGCAT TCAGTTGCAA CGGCCGCGGC AGCTGGCTTT 
0301 CCCTGCACTG GATTTCCACT TCCTCCTGGT CGAAGCAGCC GCAGCAGCAG CAGCAATAAC 
0361 AATCAGGAAC AGCAGCAGCA GCAGCAACAA GAAGCCGTCA AACGCCGCAA CTA 
 Assemble Data

31044R-2.IR_full       1   GCCGGAACACCTTTCAACCCCGTGGGCCATTGTTAGTGCTCCGTGGCTAGGGATAGATGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     1   GCCGGAACACCTTTCAACCCCGTGGGCCATTGTTAGTGCTCCGTGGCTAGGGATAGATGG 60


31044R-2.IR_full       61  CTACTGTATGGCCACTTGCTGCACGGCCATGAAGCTACTCCTCCCACACGATTTGCTTCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     61  CTACTGTATGGCCACTTGCTGCACGGCCATGAAGCTACTCCTCCCACACGATTTGCTTCA 120


31044R-2.IR_full       121 CGCTCATTTAAATGCCAACGCACCGGAGGGAGGAGAGAGCAGGGCACTTCACTTCGGCGG 180
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
31044R-2.in silico     121 CGCTCATTTAAATGCCAACGCACCGCAGGGAGGAGAGAGCAGGGCACTTCACTTCGGCGG 180


31044R-2.IR_full       181 CTCGGCTGGCTTATTTACATATTTTCTAAATGAATATGGGCCCCGCGAGTTTGCAACCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     181 CTCGGCTGGCTTATTTACATATTTTCTAAATGAATATGGGCCCCGCGAGTTTGCAACCCC 240


31044R-2.IR_full       241 GACCGGCGGTGGCAAAGCCGAGAAGCGCATTCAGTTGCAACGGCCGCGGCAGCTGGCTTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     241 GACCGGCGGTGGCAAAGCCGAGAAGCGCATTCAGTTGCAACGGCCGCGGCAGCTGGCTTT 300


31044R-2.IR_full       301 CCCTGCACTGGATTTCCACTTCCTCCTGGTCGAAGCAGCCGCAGCAGCAGCAGCAATAAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     301 CCCTGCACTGGATTTCCACTTCCTCCTGGTCGAAGCAGCCGCAGCAGCAGCAGCAATAAC 360


31044R-2.IR_full       361 AATCAGGAACAGCAGCAGCAGCAGCAACAAGAAGCCGTCAAACGCCGCAACTA 413
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||
31044R-2.in silico     361 AATCAGGAACAGCAGCAGCAGCAGCAACAAGAAGCCGTCAAACGCCGCAACTA 413

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   395  46  63  NM_170400.1  CG31044-RA (CG31044), mRNA 
11.89   47  418  1126  2192  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
11.89   47  418  1126  2192  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
11.89   47  418  1126  2192  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
5.06   20  122  369  724  NM_168571.2  CG32133-RA (CG32133), mRNA 
4.3   17  161  465  1049  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
4.3   17  161  465  1049  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
3.79   15  55  222  457  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
3.79   15  55  222  457  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
3.29   13  106  248  483  NM_134474.4  CG32532-RA (CG32532), mRNA 
3.29   13  66  312  676  NM_079903.2  CG15319-RB (nej), mRNA 
3.29   13  63  246  396  NM_167000.1  CG32778-RA (CG32778), mRNA 
3.03   12  100  233  526  NM_132246.2  CG10555-RA (CG10555), mRNA 
3.03   12  81  392  873  NM_001038734.1  CG16902-RC (Hr4), mRNA 
3.03   12  62  302  560  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
3.03   12  62  292  519  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
3.03   12  59  218  425  NM_078514.2  CG9653-RA (brk), mRNA 
3.03   12  49  187  364  NM_078575.2  CG9355-RA (dy), mRNA 
3.03   12  45  180  310  NM_143700.3  CG17724-RA, transcript variant A (CG17724), mRNA 
3.03   12  34  143  350  NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
2.78   11  70  264  723  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.78   11  70  263  714  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.78   11  70  263  714  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.78   11  56  292  652  NM_139493.2  CG2083-RA (CG2083), mRNA 
2.78   11  50  169  309  NM_057495.3  CG5058-RB, transcript variant B (grh), mRNA 
2.78   11  50  169  309  NM_057494.3  CG5058-RA, transcript variant A (grh), mRNA 
2.78   11  49  234  548  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
2.78   11  49  234  547  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
2.78   11  49  208  501  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
2.78   11  41  183  442  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.