National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3101R-2 
 Symbol l(1)G0232  Full Name lethal (1) G0232 
 CG No CG32697  Old CG No CG3101 
 Synonyms CG3101, CG3102, MEG2, unnamed, CG32697, l(1)G0232 
 Accession No (Link to NCBI) NM_132348.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGATCCTGCGTCTGTTCGTGCGCGAGAAGCTGCGCGAGCGAGTGTTCACTGTATCGGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCTCAATTGGCGCTGCACGTGCCGCGCAAGGCGCTGCCCATTCACTTGGGTGGCACGCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAGGTCGATCACGCCACATGGTTGCTCAGCTGCCGCCAATCGATGACGAATCGTGAGGAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGCTGCTGGCCAATATCGTGGGTGTGGGCGGTGGATCCGGATCCGGTTCAGCAGCTGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCAGCAGCAATTGTGTCCACCAATGGCACGGAAACCGAGGCCGCGACAACGGCAGCCACG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATAATCAGCGCCGTCCACCAGTTGGGCGATAATAATACCACCGTGGTGACGGTCAGCAAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCGTCGGTCCAGCTGGATCGGCATCTGGCGGAGCAACGACAGCAGCGTCGGCGGCGACG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAACCCAACGAAAATATCACAATCAACGGACTGAGTCCAAGCCACCGTCAGGCGGCGAAT 480

3101R-2.IR_full       481 AACAGCAGTAGCAGTAGCAG 500
                          |||||||||||||||||||| silico     481 AACAGCAGTAGCAGTAGCAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
100   482  NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
100   482  NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
100   482  NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
100   482  NM_167199.1  CG32697-RD, transcript variant D (l(1)G0232), mRNA 
100   482  NM_001014729.1  CG32697-RE, transcript variant E (l(1)G0232), mRNA 
0.41   NM_137962.2  CG3941-RA, transcript variant A (pita), mRNA 
0.41   NM_166607.1  CG3941-RB, transcript variant B (pita), mRNA 
0.2   NM_143297.1  CG3361-RA (mrt), mRNA 
0   NM_001038817.1  CG4551-RD, transcript variant D (smi35A), mRNA 
0   NM_001038818.1  CG4551-RE, transcript variant E (smi35A), mRNA 
0   NM_205989.2  CG4551-RB, transcript variant B (smi35A), mRNA 
0   NM_078840.4  CG4551-RA, transcript variant A (smi35A), mRNA 
0   NM_205988.2  CG4551-RC, transcript variant C (smi35A), mRNA 
0   NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0   NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
0   23  231  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   23  231  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   23  231  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   21  NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   21  NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   26  NM_169851.1  CG31475-RA (CG31475), mRNA 
0   15  NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   15  NM_164392.1  CG3365-RC, transcript variant C (drongo), mRNA 
0   15  NM_164391.1  CG3365-RA, transcript variant A (drongo), mRNA 
0   NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
0   NM_136949.1  CG13151-RA (CG13151), mRNA 
0   22  NM_080362.2  CG31868-RA (Samuel), mRNA 
0   12  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   12  NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.