National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3101R-1 
 Symbol l(1)G0232  Full Name lethal (1) G0232 
 CG No CG32697  Old CG No CG3101 
 Synonyms CG3101, CG3102, MEG2, unnamed, CG32697, l(1)G0232 
 Accession No (Link to NCBI) NM_132348.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGATCCTGCGTCTGTTCGTG 
 Primer Seq. 3'
aatctagaggtaccCTGCTACTGCTACTGCTGTTA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGATCCTGC GTCTGTTCGT GCGCGAGAAg CTGCGCGAGC GAGTGTTCAC TGTATCGGTG 
0061 CCTCAATTGG CGCTGCACGT GCcgCGCAAG GcGCTGCCCA TTCACTTGGG TGGCACGCTG 
0121 GAGGTCGATC ACGCCACATG GTTGCTCAGC TGCCGCCAAT CGATGACGAA TCGTGAGGAC 
0181 GAGCTGCTGG CCAATATCGT GGGTGTGGGC GGTGGATCCG GATCCGGTTC AGCAGCTGGA 
0241 TCAGCAGCAA TTGTGTCCAC CAATGGCACG GAAACCGAGG CCGCGACAAC GGCAGCCACG 
0301 ATAATCAGCG CCGTCCACCA GTTGGGCGAT AATAATACCA CCGTGGTGAC GGTCAGCAAT 
0361 GGCGTCGGTC CAGCTGGATC GGCATCTGGC GGAGCAACGA CAGCAGCGTC GGCGGCGACG 
0421 GAACCCAACG AAAATATCAC AATCAACGGA CTGAGTCCAA GCCACCGTCA GGCGGCGAAT 
0481 AACAGCAGTA GCAGTAGCAG  
 in silico PCR Fragment
0001 AAGATCCTGC GTCTGTTCGT GCGCGAGAAG CTGCGCGAGC GAGTGTTCAC TGTATCGGTG 
0061 CCTCAATTGG CGCTGCACGT GCCGCGCAAG GCGCTGCCCA TTCACTTGGG TGGCACGCTG 
0121 GAGGTCGATC ACGCCACATG GTTGCTCAGC TGCCGCCAAT CGATGACGAA TCGTGAGGAC 
0181 GAGCTGCTGG CCAATATCGT GGGTGTGGGC GGTGGATCCG GATCCGGTTC AGCAGCTGGA 
0241 TCAGCAGCAA TTGTGTCCAC CAATGGCACG GAAACCGAGG CCGCGACAAC GGCAGCCACG 
0301 ATAATCAGCG CCGTCCACCA GTTGGGCGAT AATAATACCA CCGTGGTGAC GGTCAGCAAT 
0361 GGCGTCGGTC CAGCTGGATC GGCATCTGGC GGAGCAACGA CAGCAGCGTC GGCGGCGACG 
0421 GAACCCAACG AAAATATCAC AATCAACGGA CTGAGTCCAA GCCACCGTCA GGCGGCGAAT 
0481 AACAGCAGTA GCAGTAGCAG  
 Assemble Data

3101R-1.IR_full       1   AAGATCCTGCGTCTGTTCGTGCGCGAGAAGCTGCGCGAGCGAGTGTTCACTGTATCGGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     1   AAGATCCTGCGTCTGTTCGTGCGCGAGAAGCTGCGCGAGCGAGTGTTCACTGTATCGGTG 60


3101R-1.IR_full       61  CCTCAATTGGCGCTGCACGTGCCGCGCAAGGCGCTGCCCATTCACTTGGGTGGCACGCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     61  CCTCAATTGGCGCTGCACGTGCCGCGCAAGGCGCTGCCCATTCACTTGGGTGGCACGCTG 120


3101R-1.IR_full       121 GAGGTCGATCACGCCACATGGTTGCTCAGCTGCCGCCAATCGATGACGAATCGTGAGGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     121 GAGGTCGATCACGCCACATGGTTGCTCAGCTGCCGCCAATCGATGACGAATCGTGAGGAC 180


3101R-1.IR_full       181 GAGCTGCTGGCCAATATCGTGGGTGTGGGCGGTGGATCCGGATCCGGTTCAGCAGCTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     181 GAGCTGCTGGCCAATATCGTGGGTGTGGGCGGTGGATCCGGATCCGGTTCAGCAGCTGGA 240


3101R-1.IR_full       241 TCAGCAGCAATTGTGTCCACCAATGGCACGGAAACCGAGGCCGCGACAACGGCAGCCACG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     241 TCAGCAGCAATTGTGTCCACCAATGGCACGGAAACCGAGGCCGCGACAACGGCAGCCACG 300


3101R-1.IR_full       301 ATAATCAGCGCCGTCCACCAGTTGGGCGATAATAATACCACCGTGGTGACGGTCAGCAAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     301 ATAATCAGCGCCGTCCACCAGTTGGGCGATAATAATACCACCGTGGTGACGGTCAGCAAT 360


3101R-1.IR_full       361 GGCGTCGGTCCAGCTGGATCGGCATCTGGCGGAGCAACGACAGCAGCGTCGGCGGCGACG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     361 GGCGTCGGTCCAGCTGGATCGGCATCTGGCGGAGCAACGACAGCAGCGTCGGCGGCGACG 420


3101R-1.IR_full       421 GAACCCAACGAAAATATCACAATCAACGGACTGAGTCCAAGCCACCGTCAGGCGGCGAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3101R-1.in silico     421 GAACCCAACGAAAATATCACAATCAACGGACTGAGTCCAAGCCACCGTCAGGCGGCGAAT 480


3101R-1.IR_full       481 AACAGCAGTAGCAGTAGCAG 500
                          ||||||||||||||||||||
3101R-1.in silico     481 AACAGCAGTAGCAGTAGCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167197.1  CG32697-RC, transcript variant C (l(1)G0232), mRNA 
100   482  NM_001014728.1  CG32697-RF, transcript variant F (l(1)G0232), mRNA 
100   482  NM_132348.2  CG32697-RA, transcript variant A (l(1)G0232), mRNA 
100   482  NM_167198.1  CG32697-RB, transcript variant B (l(1)G0232), mRNA 
100   482  NM_167199.1  CG32697-RD, transcript variant D (l(1)G0232), mRNA 
100   482  NM_001014729.1  CG32697-RE, transcript variant E (l(1)G0232), mRNA 
0.41   NM_137962.2  CG3941-RA, transcript variant A (pita), mRNA 
0.41   NM_166607.1  CG3941-RB, transcript variant B (pita), mRNA 
0.2   NM_143297.1  CG3361-RA (mrt), mRNA 
0   NM_001038817.1  CG4551-RD, transcript variant D (smi35A), mRNA 
0   NM_001038818.1  CG4551-RE, transcript variant E (smi35A), mRNA 
0   NM_205989.2  CG4551-RB, transcript variant B (smi35A), mRNA 
0   NM_078840.4  CG4551-RA, transcript variant A (smi35A), mRNA 
0   NM_205988.2  CG4551-RC, transcript variant C (smi35A), mRNA 
0   NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0   NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
0   23  231  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   23  231  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   23  231  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   21  NM_057421.2  CG8651-RD, transcript variant D (trx), mRNA 
0   21  NM_134282.1  CG8651-RA, transcript variant A (trx), mRNA 
0   26  NM_169851.1  CG31475-RA (CG31475), mRNA 
0   15  NM_057891.2  CG3365-RB, transcript variant B (drongo), mRNA 
0   15  NM_164392.1  CG3365-RC, transcript variant C (drongo), mRNA 
0   15  NM_164391.1  CG3365-RA, transcript variant A (drongo), mRNA 
0   NM_137083.2  CG8233-RB, transcript variant B (CG8233), mRNA 
0   NM_136949.1  CG13151-RA (CG13151), mRNA 
0   22  NM_080362.2  CG31868-RA (Samuel), mRNA 
0   12  NM_132779.1  CG15028-RB, transcript variant B (CG15028), mRNA 
0   12  NM_167431.1  CG15028-RA, transcript variant A (CG15028), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.