National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3099R-3 
 Symbol CG3099  Full Name CG3099 
 CG No CG3099  Old CG No CG3099 
 Synonyms CG3099 
 Accession No (Link to NCBI) NM_132347.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Du J, Zhang J, Su Y, Liu M, Ospina JK, Yang S, Zhu AJ.
In vivo RNAi screen reveals neddylation genes as novel regulators of Hedgehog signaling.
PLoS One (2011) 6(9) e24168 [ PubMed ID = 21931660 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCACCATTTCGCAGAGATTT 
 Primer Seq. 3'
aatctagaggtaccATTGGAGCGACTGATGGAACT 
 Predicted Fragment Size
518 
 IR fragment full Seq
0001 GCCACCATTT CGCAGAGATT TCGAGGCCAA ACTGCGCAGT TTCTATCGCA AACTAGAGTC 
0061 CAAGGGCTAC GGACAAGGAC CACACAAGCT TAAACTGCAC ATTCGTCGCA GCCATTTGCT 
0121 GGAGGACGCC TTCCGgcNCA TCATGTCCGC CAACAAGAAG GACCTGCAAC GCGGCCGACT 
0181 CGCCGTGCTC TGGGATACGG AGGAGGGCCT GGACTATGGC GGACCATCAC GCGAGTTCTT 
0241 CTTCCTACTT TCGCGCGAAC TGTTTAATCC GTACTACGGA CTGTTCGAGT ACTCAGCCAA 
0301 CGATACGTAC ACCGTGCAGG TGTCACCATT GTCGGCGTTC GTGGATAATT GCCACGATTG 
0361 GTTCCGCTTT AGTGGACGAG TTTTGGGATT GGCACTGGTA CATCAGTATC TACTGGACGC 
0421 ATTCTTTACG CGTCCCTTTT ANCAAGGCGC TGCTGCGCCT GNCNCCGTGG CTCTCAGTGA 
0481 TTTGGAGTCG CTGGACAATG AGTTCCATCA GTCGCTCCAA T 
 in silico PCR Fragment
0001 GCCACCATTT CGCAGAGATT TCGAGGCCAA ACTGCGCAGT TTCTATCGCA AACTAGAGTC 
0061 CAAGGGCTAC GGACAAGGAC CACACAAGCT TAAACTGCAC ATTCGTCGCA GCCATTTGCT 
0121 GGAGGACGCC TTCCGGCGCA TCATGTCCGC CAACAAGAAG GACCTGCAAC GCGGCCGACT 
0181 CGCCGTGCTC TGGGATACGG AGGAGGGCCT GGACTATGGC GGACCATCAC GCGAGTTCTT 
0241 CTTCCTACTT TCGCGCGAAC TGTTTAATCC GTACTACGGA CTGTTCGAGT ACTCAGCCAA 
0301 CGATACGTAC ACCGTGCAGG TGTCACCATT GTCGGCGTTC GTGGATAATT GCCACGATTG 
0361 GTTCCGCTTT AGTGGACGAG TTTTGGGATT GGCACTGGTA CATCAGTATC TACTGGACGC 
0421 ATTCTTTACG CGTCCCTTTT A-CAAGGCGC TGCTGCGCCT G--CCCGTGG CTCTCAGTGA 
0481 TTTGGAGTCG CTGGACAATG AGTTCCATCA GTCGCTCCAA T 
 Assemble Data

3099R-3.IR_full       1   GCCACCATTTCGCAGAGATTTCGAGGCCAAACTGCGCAGTTTCTATCGCAAACTAGAGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     1   GCCACCATTTCGCAGAGATTTCGAGGCCAAACTGCGCAGTTTCTATCGCAAACTAGAGTC 60


3099R-3.IR_full       61  CAAGGGCTACGGACAAGGACCACACAAGCTTAAACTGCACATTCGTCGCAGCCATTTGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     61  CAAGGGCTACGGACAAGGACCACACAAGCTTAAACTGCACATTCGTCGCAGCCATTTGCT 120


3099R-3.IR_full       121 GGAGGACGCCTTCCGGCNCATCATGTCCGCCAACAAGAAGGACCTGCAACGCGGCCGACT 180
                          ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     121 GGAGGACGCCTTCCGGCGCATCATGTCCGCCAACAAGAAGGACCTGCAACGCGGCCGACT 180


3099R-3.IR_full       181 CGCCGTGCTCTGGGATACGGAGGAGGGCCTGGACTATGGCGGACCATCACGCGAGTTCTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     181 CGCCGTGCTCTGGGATACGGAGGAGGGCCTGGACTATGGCGGACCATCACGCGAGTTCTT 240


3099R-3.IR_full       241 CTTCCTACTTTCGCGCGAACTGTTTAATCCGTACTACGGACTGTTCGAGTACTCAGCCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     241 CTTCCTACTTTCGCGCGAACTGTTTAATCCGTACTACGGACTGTTCGAGTACTCAGCCAA 300


3099R-3.IR_full       301 CGATACGTACACCGTGCAGGTGTCACCATTGTCGGCGTTCGTGGATAATTGCCACGATTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     301 CGATACGTACACCGTGCAGGTGTCACCATTGTCGGCGTTCGTGGATAATTGCCACGATTG 360


3099R-3.IR_full       361 GTTCCGCTTTAGTGGACGAGTTTTGGGATTGGCACTGGTACATCAGTATCTACTGGACGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     361 GTTCCGCTTTAGTGGACGAGTTTTGGGATTGGCACTGGTACATCAGTATCTACTGGACGC 420


3099R-3.IR_full       421 ATTCTTTACGCGTCCCTTTTANCAAGGCGCTGCTGCGCCTGNCNCCGTGGCTCTCAGTGA 480
                          ||||||||||||||||||||| |||||||||||||||||||   ||||||||||||||||
3099R-3.in silico     421 ATTCTTTACGCGTCCCTTTTA-CAAGGCGCTGCTGCGCCTG--CCCGTGGCTCTCAGTGA 480


3099R-3.IR_full       481 TTTGGAGTCGCTGGACAATGAGTTCCATCAGTCGCTCCAAT 521
                          |||||||||||||||||||||||||||||||||||||||||
3099R-3.in silico     481 TTTGGAGTCGCTGGACAATGAGTTCCATCAGTCGCTCCAAT 521

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   500  NM_132347.1  CG3099-RB (CG3099), mRNA 
0.8   16  NM_168736.1  CG7555-RC, transcript variant C (Nedd4), mRNA 
0.8   16  NM_140736.2  CG7555-RA, transcript variant A (Nedd4), mRNA 
0.8   16  NM_168737.1  CG7555-RB, transcript variant B (Nedd4), mRNA 
0.8   16  NM_206394.1  CG7555-RD, transcript variant D (Nedd4), mRNA 
0.4   16  NM_079055.2  CG4943-RA (lack), mRNA 
0   NM_167916.2  CG32315-RA (dlt), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_142497.2  CG18208-RA (CG18208), mRNA 
0   NM_137507.3  CG5341-RA (sec6), mRNA 
0   NM_139737.1  CG13287-RA (CG13287), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_142937.2  CG13599-RA (CG13599), mRNA 
0   NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   NM_140672.2  CG9951-RA (CG9951), mRNA 
0   NM_170094.2  CG13598-RA, transcript variant A (sba), mRNA 
0   NM_176549.1  CG13598-RB, transcript variant B (sba), mRNA 
0   NM_169815.2  CG31122-RA (CG31122), mRNA 
0   NM_079229.1  CG8624-RA, transcript variant A (melt), mRNA 
0   NM_001014572.1  CG8624-RB, transcript variant B (melt), mRNA 
0   NM_001015220.1  CG41141-PA (CG41141), mRNA 
0   NM_140347.1  CG11008-RA (CG11008), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_168756.1  CG8127-RC, transcript variant C (Eip75B), mRNA 
0   NM_168757.1  CG8127-RD, transcript variant D (Eip75B), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.