National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30502R-4 
 Symbol CG30502  Full Name CG30502 
 CG No CG30502  Old CG No CG30502 
 Synonyms CG1645, CG1642, CG30502 
 Accession No (Link to NCBI) NM_136435.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Carvalho M, Schwudke D, Sampaio JL, Palm W, Riezman I, Dey G, Gupta GD, Mayor S, Riezman H, Shevchenko A, Kurzchalia TV, Eaton S.
Survival strategies of a sterol auxotroph.
Development (2010) 137(21) 3675-85 [ PubMed ID = 20940226 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAAGGAAGCGGAGTCGAACG 
 Primer Seq. 3'
aatctagaggtaccTGGTATCCAGAACAGGGGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAAGGAAGC GGAGTCGAAC GACAAGTTCA TAGTAAAGTA TCGCCAGCAG TATTACGATT 
0061 TGTCCAGGTT TATGCACAAG CATCCGGGAG GCATAAACAC ACTCAAAGGT CTCAACAGCG 
0121 GGGACATGAC AGCTCGCTTC CTAAAAGGCG CCGCCACATT CGGATGCGGC CATGTACTTG 
0181 ATGAGGGAGT ACAAAATCGA TCCAGAGGAC TCTCGGAAAC CAAAGTCGAG CCAAAGGGAA 
0241 ACGTTGCATC ACGATGAAGA TGGGACTTTG CGACAACGGC CCAGGGAAAC GGAGGACAAG 
0301 AACAATAACC AGGTGGACGA TAGTATGGAG CACCTAGTGG ACTGGTCTAA GGCAATGCTT 
0361 CCGCAGATAG CTAACATAAC GGATTGCTAC GATGAGTGGG TTCACAAGCC GGTGGACAGG 
0421 CCACTGCGTC TCTTTGACCC TTGGTACTTG GAGATGTGCA CCAAGACGCC CTGGTgGCTG 
0481 GTGCCCCTGT TCTGGATACC A 
 in silico PCR Fragment
0001 CAAAGGAAGC GGAGTCGAAC GACAAGTTCA TAGTAAAGTA TCGCCAGCAG TATTACGATT 
0061 TGTCCAGGTT TATGCACAAG CATCCGGGAG GCATAAACAC ACTCAAAGGT CTCAACAGCG 
0121 GGGACATGAC AGCTCGCTTC CT-AAAGGCG CCGCCACATT CGGATGCGGC CATGTACTTG 
0181 ATGAGGGAGT ACAAAATCGA TCCAGAGGAC TCTCGGAAAC CAAAGTCGAG CCAAAGGGAA 
0241 ACGTTGCATC ACGATGAAGA TGGGACTTTG CGACAACGGC CCAGGGAAAC GGAGGACAAG 
0301 AACAATAACC AGGTGGACGA TAGTATGGAG CACCTAGTGG ACTGGTCTAA GGCAATGCTT 
0361 CCGCAGATAG CTAACATAAC GGATTGCTAC GATGAGTGGG TTCACAAGCC GGTGGACAGG 
0421 CCACTGCGTC TCTTTGACCC TTGGTACTTG GAGATGTGCA CCAAGACGCC CTGGTGGCTG 
0481 GTGCCCCTGT TCTGGATACC A 
 Assemble Data

30502R-4.IR_full       1   CAAAGGAAGCGGAGTCGAACGACAAGTTCATAGTAAAGTATCGCCAGCAGTATTACGATT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     1   CAAAGGAAGCGGAGTCGAACGACAAGTTCATAGTAAAGTATCGCCAGCAGTATTACGATT 60


30502R-4.IR_full       61  TGTCCAGGTTTATGCACAAGCATCCGGGAGGCATAAACACACTCAAAGGTCTCAACAGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     61  TGTCCAGGTTTATGCACAAGCATCCGGGAGGCATAAACACACTCAAAGGTCTCAACAGCG 120


30502R-4.IR_full       121 GGGACATGACAGCTCGCTTCCTAAAAGGCGCCGCCACATTCGGATGCGGCCATGTACTTG 180
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
30502R-4.in silico     121 GGGACATGACAGCTCGCTTCCT-AAAGGCGCCGCCACATTCGGATGCGGCCATGTACTTG 180


30502R-4.IR_full       181 ATGAGGGAGTACAAAATCGATCCAGAGGACTCTCGGAAACCAAAGTCGAGCCAAAGGGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     181 ATGAGGGAGTACAAAATCGATCCAGAGGACTCTCGGAAACCAAAGTCGAGCCAAAGGGAA 240


30502R-4.IR_full       241 ACGTTGCATCACGATGAAGATGGGACTTTGCGACAACGGCCCAGGGAAACGGAGGACAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     241 ACGTTGCATCACGATGAAGATGGGACTTTGCGACAACGGCCCAGGGAAACGGAGGACAAG 300


30502R-4.IR_full       301 AACAATAACCAGGTGGACGATAGTATGGAGCACCTAGTGGACTGGTCTAAGGCAATGCTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     301 AACAATAACCAGGTGGACGATAGTATGGAGCACCTAGTGGACTGGTCTAAGGCAATGCTT 360


30502R-4.IR_full       361 CCGCAGATAGCTAACATAACGGATTGCTACGATGAGTGGGTTCACAAGCCGGTGGACAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     361 CCGCAGATAGCTAACATAACGGATTGCTACGATGAGTGGGTTCACAAGCCGGTGGACAGG 420


30502R-4.IR_full       421 CCACTGCGTCTCTTTGACCCTTGGTACTTGGAGATGTGCACCAAGACGCCCTGGTGGCTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30502R-4.in silico     421 CCACTGCGTCTCTTTGACCCTTGGTACTTGGAGATGTGCACCAAGACGCCCTGGTGGCTG 480


30502R-4.IR_full       481 GTGCCCCTGTTCTGGATACCA 501
                           |||||||||||||||||||||
30502R-4.in silico     481 GTGCCCCTGTTCTGGATACCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136435.2  CG30502-RA (CG30502), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_170089.1  CG10367-RA, transcript variant A (Hmgcr), mRNA 
0   NM_206548.1  CG10367-RB, transcript variant B (Hmgcr), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_133104.2  CG7282-RA (CG7282), mRNA 
0   NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_079859.2  CG1438-RA (Cyp4c3), mRNA 
0   NM_170028.1  CG31159-RA (CG31159), mRNA 
0   NM_080042.2  CG5827-RA, transcript variant A (RpL37A), mRNA 
0   NM_137945.1  CG30414-RA (CG30414), mRNA 
0   NM_136707.2  CG1371-RA (CG1371), mRNA 
0   NM_167926.2  CG12026-RB, transcript variant B (CG12026), mRNA 
0   NM_139417.2  CG12026-RA, transcript variant A (CG12026), mRNA 
0   NM_169293.1  CG8208-RA, transcript variant A (MBD-like), mRNA 
0   NM_141650.2  CG8208-RB, transcript variant B (MBD-like), mRNA 
0   10  NM_136450.2  CG2140-RB, transcript variant B (Cyt-b5), mRNA 
0   10  NM_165540.2  CG2140-RA, transcript variant A (Cyt-b5), mRNA 
0   NM_078530.2  CG11202-RA (org-1), mRNA 
0   NM_079668.2  CG7467-RB, transcript variant B (osa), mRNA 
0   NM_169775.1  CG7467-RA, transcript variant A (osa), mRNA 
0   NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_137223.1  CG8302-RA (Cyp4aa1), mRNA 
0   NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.