National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3044R-3 
 Symbol CG3044  Full Name CG3044 
 CG No CG3044  Old CG No CG3044 
 Synonyms CG3044 
 Accession No (Link to NCBI) NM_132133.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTGCGAACTTTGGTCTGCTG 
 Primer Seq. 3'
aatctagaggtaccGCTGCGAGAGATGCATTCGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTGCGAACT TTGGTCTGCT GGAGTGCTTT GTTGTTCTCT TTGTTGTGCC TTTGCCTCGG 
0061 GTTCATCGGC CTGGGATTAC TCGGCATCCA AACTGGGGAA GTGCACAAGG TGGGGCAGCG 
0121 ATTGGTGTGC TACTACGCCA GCGATGGCAC CCACAATCTC AGCCTTTTGG ATGTTCCCGG 
0181 CGATCTGTGC ACCCACATCA ATATCGGACC CGCCACTTTG GATAATGCCA CCATAGTCCT 
0241 TCCCGATAcC CTCAGACAGG TACTACAGAA CGACACCCGA TCCTTTCGTG CTGCCCATCC 
0301 GCAGGTTCAC CTGCTTCTCT GGATCGGTGG CGCCGACAGT GGGCGGTCAT TTGCCCTCAT 
0361 GGTgGCGAAC CACgCCATGC GAAAGTTGTT CCTGCGctNC CTCCGGGAAA TATTGCGCAC 
0421 CTATCCCAGT TTGGATGGCA TCGATCTCGA CTGGGAGTTT CCGAGTGCCT ACGATCGTGA 
0481 GcGAATGCAT CTCTCGCAGC  
 in silico PCR Fragment
0001 CCTGCGAACT TTGGTCTGCT GGAGTGCTTT GTTGTTCTCT TTGTTGTGCC TTTGCCTCGG 
0061 GTTCATCGGC CTGGGATTAC TCGGCATCCA AACTGGGGAA GTGCACAAGG TGGGGCAGCG 
0121 GTTGGTGTGC TACTACGCAA GCGATGGCAC CCACAATCTC AGCCTTTTGG ATGTTCCCGG 
0181 CGACCTGTGC ACCCACATCA ATATCGGACC CGCCACTTTG GATAATGCCA CCATAGTCCT 
0241 TCCCGATACC CTCAGACAGG TACTACAGAA CGACACCCGA TCCTTTCGTG CTGCCCATCC 
0301 GCAGGTTCAC CTGCTTCTCT GGATCGGTGG CGCCGACAGT GGGCGGTCAT TTGCCCTCAT 
0361 GGTGGCGAAC CACGCCATGC GAAAGTTGTT CCTGCGCTCC CTCCGGGAAA TATTGCGCAC 
0421 CTATCCCAGT TTGGATGGCA TCGATCTCGA CTGGGAGTTT CCGAGTGCCT ACGATCGTGA 
0481 GCGAATGCAT CTCTCGCAGC  
 Assemble Data

3044R-3.IR_full       1   CCTGCGAACTTTGGTCTGCTGGAGTGCTTTGTTGTTCTCTTTGTTGTGCCTTTGCCTCGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     1   CCTGCGAACTTTGGTCTGCTGGAGTGCTTTGTTGTTCTCTTTGTTGTGCCTTTGCCTCGG 60


3044R-3.IR_full       61  GTTCATCGGCCTGGGATTACTCGGCATCCAAACTGGGGAAGTGCACAAGGTGGGGCAGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     61  GTTCATCGGCCTGGGATTACTCGGCATCCAAACTGGGGAAGTGCACAAGGTGGGGCAGCG 120


3044R-3.IR_full       121 ATTGGTGTGCTACTACGCCAGCGATGGCACCCACAATCTCAGCCTTTTGGATGTTCCCGG 180
                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     121 GTTGGTGTGCTACTACGCAAGCGATGGCACCCACAATCTCAGCCTTTTGGATGTTCCCGG 180


3044R-3.IR_full       181 CGATCTGTGCACCCACATCAATATCGGACCCGCCACTTTGGATAATGCCACCATAGTCCT 240
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     181 CGACCTGTGCACCCACATCAATATCGGACCCGCCACTTTGGATAATGCCACCATAGTCCT 240


3044R-3.IR_full       241 TCCCGATACCCTCAGACAGGTACTACAGAACGACACCCGATCCTTTCGTGCTGCCCATCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     241 TCCCGATACCCTCAGACAGGTACTACAGAACGACACCCGATCCTTTCGTGCTGCCCATCC 300


3044R-3.IR_full       301 GCAGGTTCACCTGCTTCTCTGGATCGGTGGCGCCGACAGTGGGCGGTCATTTGCCCTCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     301 GCAGGTTCACCTGCTTCTCTGGATCGGTGGCGCCGACAGTGGGCGGTCATTTGCCCTCAT 360


3044R-3.IR_full       361 GGTGGCGAACCACGCCATGCGAAAGTTGTTCCTGCGCTNCCTCCGGGAAATATTGCGCAC 420
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
3044R-3.in silico     361 GGTGGCGAACCACGCCATGCGAAAGTTGTTCCTGCGCTCCCTCCGGGAAATATTGCGCAC 420


3044R-3.IR_full       421 CTATCCCAGTTTGGATGGCATCGATCTCGACTGGGAGTTTCCGAGTGCCTACGATCGTGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3044R-3.in silico     421 CTATCCCAGTTTGGATGGCATCGATCTCGACTGGGAGTTTCCGAGTGCCTACGATCGTGA 480


3044R-3.IR_full       481 GCGAATGCATCTCTCGCAGC 500
                          ||||||||||||||||||||
3044R-3.in silico     481 GCGAATGCATCTCTCGCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132133.1  CG3044-RA (CG3044), mRNA 
0.41   11  NM_142057.2  CG9307-RA (CG9307), mRNA 
0.2   NM_079741.2  CG10210-RA (tst), mRNA 
0   12  NM_137477.2  CG5154-RA (Idgf5), mRNA 
0   11  NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_168574.1  CG6603-RC, transcript variant C (Hsc70Cb), mRNA 
0   NM_168573.1  CG6603-RB, transcript variant B (Hsc70Cb), mRNA 
0   NM_140430.2  CG6603-RA, transcript variant A (Hsc70Cb), mRNA 
0   NM_057950.2  CG2054-RA (Cht2), mRNA 
0   NM_078956.2  CG12210-RA, transcript variant A (Syb), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 
0   NM_057754.2  CG9484-RA (hyd), mRNA, type I CG4099-RA (Sr-CI), mRNA 
0   NM_168038.1  CG32264-RD, transcript variant D (CG32264), mRNA 
0   NM_137871.2  CG3536-RA (CG3536), mRNA 
0   NM_166551.2  CG30267-RA (CG30267), mRNA 
0   NM_143318.2  CG31057-RA (tau), mRNA 
0   18  20  NM_205954.2  CG33300-RA (CG33300), mRNA 
0   55  NM_175960.3  CG33196-RB (dp), mRNA 
0   11  NM_167207.1  CG1780-RB, transcript variant B (Idgf4), mRNA 
0   11  NM_078546.2  CG1780-RA, transcript variant A (Idgf4), mRNA 
0   NM_143058.1  CG13645-RA, transcript variant A (Nmnat), mRNA 
0   NM_170185.1  CG13645-RB, transcript variant B (Nmnat), mRNA 
0   NM_165411.1  CG6448-RA, transcript variant A (CG6448), mRNA 
0   NM_136290.2  CG6448-RB, transcript variant B (CG6448), mRNA 
0   NM_135451.1  CG3818-RA (CG3818), mRNA 
0   NM_167325.1  CG11138-RB, transcript variant B (CG11138), mRNA 
0   NM_132581.1  CG11138-RC, transcript variant C (CG11138), mRNA 
0   NM_135028.2  CG15625-RA (CG15625), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.