National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30444R-2 
 Symbol l(2)01289  Full Name lethal (2) 01289 
 CG No CG9432  Old CG No CG30444 
 Synonyms CG9432, CG30444, CG9435, l(2)01289 
 Accession No (Link to NCBI) NM_143769.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTCTCGCTGCTCGTGTGTGC 
 Primer Seq. 3'
aatctagaggtaccCGAAGTCGGTGTCCTCGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTCTCGCTG CTCGTGTGTG CTCTGCTGGC CCTGAGTTTT CCCGGACATG TGAGTGGTGC 
0061 AGGCAACAAC AACAACAAGA AGGGCTCGCA GCCAGTGGCN CCNCCGGAGc CGGAGGccNT 
0121 CNATCGAGGA GGTCAATGCC AAGCAGCTGG AGAAGCTCCT GGCCGACAAG GATTACGTGG 
0181 CCGTTTTCTG GTATGCGCGA ANGCTGCGTG ACCTGTGATA AGGTTTTAGC GGAACTCGAG 
0241 AAAATCGACG ATGACACCGA CTCCTTCGGT GTGGACTTCG TGAAAATCAA CGACAAACGA 
0301 CTAGCCAAAC AGTATGGCAT CAAGAACTTC CCCGCCCTCA CCTACTTCAG GGAAAAGGAG 
0361 CCCATCATAT ATGATGGGGA TCTCATGGAC GAGGAAGGAG TGCTCGATTT CCTCACCTCC 
0421 TTGGAGGCCA TGGACTTGCC CGATCGCATC GAGGAGGTCA ATGCCAAGAT ATTGCAGAAG 
0481 ATCATCGAGG ACACCGACTT CG 
 in silico PCR Fragment
0001 TCTCTCGCTG CTCGTGTGTG CTCTGCTGGC CCTGAGTTTT CCCGGACATG TGAGTGGTGC 
0061 AGGCAACAAC AACAACAAGA AGGGCTCGCA GCCAGTGGCG CCTCCGGAGC CGGAGGCCGT 
0121 C-ATCGAGGA GGTCAATGCC AAGCAGCTGG AGAAGCTCCT GGCCGACAAG GATTACGTGG 
0181 CCGTTTTCTG GTATGCGCGA A-GCTGCGTG ACCTGTGATA AGGTTTTAGC GGAACTCGAG 
0241 AAAATCGACG ATGACACCGA CTCCTTCGGT GTGGACTTCG TGAAAATCAA CGACAAACGA 
0301 CTAGCCAAAC AGTATGGCAT CAAGAACTTC CCCGCCCTCA CCTACTTCAG GGAAAAGGAG 
0361 CCCATCATAT ATGATGGGGA TCTCATGGAC GAGGAAGGAG TGCTCGATTT CCTCACCTCC 
0421 TTGGAGGCCA TGGACTTGCC CGATCGCATC GAGGAGGTCA ATGCCAAGAT ATTGCAGAAG 
0481 ATCATCGAGG ACACCGACTT CG 
 Assemble Data

30444R-2.IR_full       1   TCTCTCGCTGCTCGTGTGTGCTCTGCTGGCCCTGAGTTTTCCCGGACATGTGAGTGGTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     1   TCTCTCGCTGCTCGTGTGTGCTCTGCTGGCCCTGAGTTTTCCCGGACATGTGAGTGGTGC 60


30444R-2.IR_full       61  AGGCAACAACAACAACAAGAAGGGCTCGCAGCCAGTGGCNCCNCCGGAGCCGGAGGCCNT 120
                           ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
30444R-2.in silico     61  AGGCAACAACAACAACAAGAAGGGCTCGCAGCCAGTGGCGCCTCCGGAGCCGGAGGCCGT 120


30444R-2.IR_full       121 CNATCGAGGAGGTCAATGCCAAGCAGCTGGAGAAGCTCCTGGCCGACAAGGATTACGTGG 180
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     121 C-ATCGAGGAGGTCAATGCCAAGCAGCTGGAGAAGCTCCTGGCCGACAAGGATTACGTGG 180


30444R-2.IR_full       181 CCGTTTTCTGGTATGCGCGAANGCTGCGTGACCTGTGATAAGGTTTTAGCGGAACTCGAG 240
                           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     181 CCGTTTTCTGGTATGCGCGAA-GCTGCGTGACCTGTGATAAGGTTTTAGCGGAACTCGAG 240


30444R-2.IR_full       241 AAAATCGACGATGACACCGACTCCTTCGGTGTGGACTTCGTGAAAATCAACGACAAACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     241 AAAATCGACGATGACACCGACTCCTTCGGTGTGGACTTCGTGAAAATCAACGACAAACGA 300


30444R-2.IR_full       301 CTAGCCAAACAGTATGGCATCAAGAACTTCCCCGCCCTCACCTACTTCAGGGAAAAGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     301 CTAGCCAAACAGTATGGCATCAAGAACTTCCCCGCCCTCACCTACTTCAGGGAAAAGGAG 360


30444R-2.IR_full       361 CCCATCATATATGATGGGGATCTCATGGACGAGGAAGGAGTGCTCGATTTCCTCACCTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     361 CCCATCATATATGATGGGGATCTCATGGACGAGGAAGGAGTGCTCGATTTCCTCACCTCC 420


30444R-2.IR_full       421 TTGGAGGCCATGGACTTGCCCGATCGCATCGAGGAGGTCAATGCCAAGATATTGCAGAAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30444R-2.in silico     421 TTGGAGGCCATGGACTTGCCCGATCGCATCGAGGAGGTCAATGCCAAGATATTGCAGAAG 480


30444R-2.IR_full       481 ATCATCGAGGACACCGACTTCG 502
                           ||||||||||||||||||||||
30444R-2.in silico     481 ATCATCGAGGACACCGACTTCG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
101.65  490  15  25  92  NM_001043010.1  CG9432-RD, transcript variant D (l(2)01289), mRNA 
101.65  490  15  25  89  NM_165485.1  CG9432-RB, transcript variant B (l(2)01289), mRNA 
101.65  490  13  15  42  NM_143769.3  CG9432-RA, transcript variant A (l(2)01289), mRNA 
101.65  490  34  NM_001043009.1  CG9432-RE, transcript variant E (l(2)01289), mRNA 
0.2   10  21  NM_078577.2  CG4147-RB, transcript variant B (Hsc70-3), mRNA 
0.2   10  21  NM_167308.1  CG4147-RD, transcript variant D (Hsc70-3), mRNA 
0.2   10  21  NM_167306.1  CG4147-RA, transcript variant A (Hsc70-3), mRNA 
0.2   10  21  NM_167307.1  CG4147-RC, transcript variant C (Hsc70-3), mRNA 
0.2   15  NM_079683.2  CG4550-RA (ninaE), mRNA 
0.2   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 
0.2   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   11  27  NM_130677.1  CG14418-RA (CG14418), mRNA 
0   NM_132100.3  CG10695-RA (Pat1), mRNA 
0   NM_130606.2  CG3573-RA (CG3573), mRNA 
0   19  52  NM_078592.2  CG11172-RA (NFAT), mRNA 
0   16  26  NM_079002.2  CG3905-RA (Su(z)2), mRNA 
0   12  NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   20  NM_057329.3  CG10790-RB (Pig1), mRNA 
0   NM_169196.1  CG31473-RA (CG31473), mRNA 
0   16  NM_079808.2  CG5658-RA (Klp98A), mRNA 
0   NM_135695.1  CG6770-RA (CG6770), mRNA 
0   NM_168030.1  CG12010-RB, transcript variant B (CG12010), mRNA 
0   NM_139555.1  CG12010-RA, transcript variant A (CG12010), mRNA 
0   14  13  NM_142444.1  CG18599-RA (CG18599), mRNA 
0   13  NM_166441.2  CG30387-RB, transcript variant B (CG30387), mRNA 
0   13  NM_166442.2  CG30387-RC, transcript variant C (CG30387), mRNA 
0   13  NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_168825.1  CG7757-RB, transcript variant B (CG7757), mRNA 
0   NM_140899.1  CG7757-RA, transcript variant A (CG7757), mRNA 
0   NM_079973.2  CG10939-RA (Sip1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.