National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30185R-3 
 Symbol CG30185  Full Name CG30185 
 CG No CG30185  Old CG No CG30185 
 Synonyms CG30185, CG5365, anon-EST:Posey25 
 Accession No (Link to NCBI) NM_145193.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTGACGTTGCAACAGTGCAG 
 Primer Seq. 3'
aatctagaggtaccATGGTGGTGAAGTTCAGCAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTGACGTTG CNACAGTGCN GAAGATAGCA NACTGCCTGG GCGTTAATCC CGGCAAGNTG 
0061 CAGCTGAACG AGGAGCNGGT CGTAACGCGC ACGAGTGGGC AAAAGAAGAG CGTGGCCGGA 
0121 TTCGCCACGA TCCTGGAGAG CCTGGCCAGC GAGTCCAAGT CGGAGAcCGC CCAGAACAGC 
0181 AGGGCGTCGC GGGAGGTGGA AGCCCAGGTG TACCAGTGGA TCGAGTTCTC TGTGCTCTAC 
0241 GTGGCGCCCG GCTCCAAGGA CAAGTACGTG TCCAAGCAGC TTCTGGCGGA CTTCAACAAA 
0301 CTGTTTGCCA GCAAATCCTA CCTGGTGGGC CACTTCATCA CTCTAGCCGA CCTGGCCGTC 
0361 TACTATGCCA TCTACGATCT TGTGAAATCC CTTTCGCCGG TGGACAAGGA GGTATATTTG 
0421 AATCTCTcCC GCTGGTTCGA TCACCTCCAG AATCGCGCGG ATGTGCACCA GGGGCGAGCC 
0481 ACTGCTGAAC TTCACCACCA T 
 in silico PCR Fragment
0001 TGTGACGTTG CAACAGTGCA GAAGATAGCA AACTGCCTGG GCGTTAATCC CGGCAAGGTG 
0061 CAGCTGAACG AGGAGCAGGT CGTAACGCGC ACGAGTGGGC AAAAGAAGAG CGTGGCCGGA 
0121 TTCGCCTCGA TCCTGGAGAG CCTGGCCAGC GAGTCCAAGT CGGAGACCGC CCAGAACAGC 
0181 AGGGCGTCGC GGGAGGTGGA AGCCCAGGTG TACCAGTGGA TCGAGTTCTC CGTGCTCTAC 
0241 GTGGCGCCCG GCTCCAAGGA CAAGTACGTG TCCAAGCAGC TTCTGGCGGA CTTCAACAAA 
0301 CTGTTTGCCA GCAAATCCTA CCTGGTGGGC CACTTCATCA CTCTAGCCGA CCTGGCCGTC 
0361 TACTATGCCA TCTACGATCT TGTGAAATCC CTTTCGCCGG TGGACAAGGA GGTATATTTG 
0421 AATCTCTCCC GCTGGTTCGA TCACCTCCAG AATCGCGCGG ATGTGCACCA -GGGCGAGCC 
0481 ACTGCTGAAC TTCACCACCA T 
 Assemble Data

30185R-3.IR_full       1   TGTGACGTTGCNACAGTGCNGAAGATAGCANACTGCCTGGGCGTTAATCCCGGCAAGNTG 60
                           ||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||| ||
30185R-3.in silico     1   TGTGACGTTGCAACAGTGCAGAAGATAGCAAACTGCCTGGGCGTTAATCCCGGCAAGGTG 60


30185R-3.IR_full       61  CAGCTGAACGAGGAGCNGGTCGTAACGCGCACGAGTGGGCAAAAGAAGAGCGTGGCCGGA 120
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
30185R-3.in silico     61  CAGCTGAACGAGGAGCAGGTCGTAACGCGCACGAGTGGGCAAAAGAAGAGCGTGGCCGGA 120


30185R-3.IR_full       121 TTCGCCACGATCCTGGAGAGCCTGGCCAGCGAGTCCAAGTCGGAGACCGCCCAGAACAGC 180
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
30185R-3.in silico     121 TTCGCCTCGATCCTGGAGAGCCTGGCCAGCGAGTCCAAGTCGGAGACCGCCCAGAACAGC 180


30185R-3.IR_full       181 AGGGCGTCGCGGGAGGTGGAAGCCCAGGTGTACCAGTGGATCGAGTTCTCTGTGCTCTAC 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
30185R-3.in silico     181 AGGGCGTCGCGGGAGGTGGAAGCCCAGGTGTACCAGTGGATCGAGTTCTCCGTGCTCTAC 240


30185R-3.IR_full       241 GTGGCGCCCGGCTCCAAGGACAAGTACGTGTCCAAGCAGCTTCTGGCGGACTTCAACAAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30185R-3.in silico     241 GTGGCGCCCGGCTCCAAGGACAAGTACGTGTCCAAGCAGCTTCTGGCGGACTTCAACAAA 300


30185R-3.IR_full       301 CTGTTTGCCAGCAAATCCTACCTGGTGGGCCACTTCATCACTCTAGCCGACCTGGCCGTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30185R-3.in silico     301 CTGTTTGCCAGCAAATCCTACCTGGTGGGCCACTTCATCACTCTAGCCGACCTGGCCGTC 360


30185R-3.IR_full       361 TACTATGCCATCTACGATCTTGTGAAATCCCTTTCGCCGGTGGACAAGGAGGTATATTTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30185R-3.in silico     361 TACTATGCCATCTACGATCTTGTGAAATCCCTTTCGCCGGTGGACAAGGAGGTATATTTG 420


30185R-3.IR_full       421 AATCTCTCCCGCTGGTTCGATCACCTCCAGAATCGCGCGGATGTGCACCAGGGGCGAGCC 480
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
30185R-3.in silico     421 AATCTCTCCCGCTGGTTCGATCACCTCCAGAATCGCGCGGATGTGCACCA-GGGCGAGCC 480


30185R-3.IR_full       481 ACTGCTGAACTTCACCACCAT 501
                           |||||||||||||||||||||
30185R-3.in silico     481 ACTGCTGAACTTCACCACCAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_145193.1  CG30185-RA (CG30185), mRNA 
0.2   NM_141251.1  CG2016-RB (CG2016), mRNA 
0   NM_140567.2  CG6017-RA (CG6017), mRNA 
0   NM_079381.2  CG4899-RA, transcript variant A (Pdh), mRNA 
0   NM_168659.1  CG4899-RB, transcript variant B (Pdh), mRNA 
0   NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   NM_001032405.1  CG33956-RE, transcript variant E (kay), mRNA 
0   NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
0   NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
0   NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0   NM_176567.1  CG33102-RA (Hex-t1), mRNA 
0   NM_133116.1  CG14190-RA (CG14190), mRNA 
0   NM_058091.3  CG3152-RA (Trap1), mRNA 
0   NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0   NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0   NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0   NM_134916.3  CG9663-RA (CG9663), mRNA 
0   NM_001014695.1  CG11153-RB, transcript variant B (Sox102F), mRNA 
0   NM_166792.1  CG11153-RA, transcript variant A (Sox102F), mRNA 
0   NM_164935.2  CG31721-RA (Trim9), mRNA 
0   NM_167675.1  CG14213-RA, transcript variant A (CG14213), mRNA 
0   NM_134491.2  CG14213-RB, transcript variant B (CG14213), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_143391.1  CG11828-RA (CG11828), mRNA 
0   NM_143145.1  CG5111-RA (CG5111), mRNA 
0   NM_167398.1  CG32599-RA (CG32599), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.