National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30094R-1 
 Symbol CG30094  Full Name CG30094 
 CG No CG30094  Old CG No CG30094 
 Synonyms CG15700, BcDNA:SD13256, CG30094 
 Accession No (Link to NCBI) NM_166149.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCAGACGATCCAAACAAGC 
 Primer Seq. 3'
aatctagaggtaccTTTTTGGAACCTCCTCCGGTG 
 Predicted Fragment Size
469 
 IR fragment full Seq
0001 TGGCAGACGA TCCAAACAAG CCCTCTACCT CGTCGAAAAC TGAAGATGCT CCGCTGTTCC 
0061 CGCCCGCAAA ACCAGGAAAA AGAGTTGACT ATGGGACAAA CAACACATTG GAGCTACTGG 
0121 AGCGGATTCC CAGCCAGGTG GTGGATCTCA AGCTGGACGA TGTGCTGACA GCCGTCAAGG 
0181 AAGTGGATAA CCTCTGCGAC TATCCGCGCT GCGAAAACCA AAACCAGCCT GATGGGCCAA 
0241 GACTGCCAGC ATTGCAAGAA GAGATTCTGC TTCAAGCACG GACTGCCAGA GGTGCACGGA 
0301 TGTGGCGAGG AGATTAAGCG GGACGAGCGC AAGAAGTTTC TGCACCCAAA GCCGGCGAAA 
0361 ACCATCAGGC AGGAGGAGGA TGTGAAGAAT GCGAAAAAGC GTCTGGATGC TAAGTTAAAG 
0421 GAAATGCAGT TGGGGCGCAC TCAAAAAGCC ACCGGAGGAG GTTCCAAAAA  
 in silico PCR Fragment
0001 TGGCAGACGA TCCAAACAAG CCCTCTACCT CGTCGAAAAC TGAAGATGCT CCGCTGTTCC 
0061 CGCCCGCAAA ACCAGGAAAA AGAGTTGACT ATGGGACAAA CAACACATTG GAGCTACTGG 
0121 AGCGGATTCC CAGCCAGGTG GTGGATCTCA AGCTGGACGA TGTGCTGACA GCCGTCAAGG 
0181 AAGTGGATAA CCTCTGCGAC TATCCGCGCT GC-AAGACCA AAACCAGCCT GATGGGCCAA 
0241 GACTGCCAGC ATTGCAAGAA GAGATTCTGC TTCAAGCACG GACTGCCAGA GGTGCACGGG 
0301 TGTGGCGAGG AGATCAAGCG GGACGAGCGC AAGAAGTTTC TGCACCCGAA GCCGGCGAAA 
0361 ACCATCAGGC AGGAGGAGGA TGTGAAGAAT GCAAAAAAGC GTCTGGATGC TAAGTTAAAG 
0421 GAAATGCAGT TGGGGCGCAC TCAAAAAGCC ACCGGAGGAG GTTCCAAAAA  
 Assemble Data

30094R-1.IR_full       1   TGGCAGACGATCCAAACAAGCCCTCTACCTCGTCGAAAACTGAAGATGCTCCGCTGTTCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30094R-1.in silico     1   TGGCAGACGATCCAAACAAGCCCTCTACCTCGTCGAAAACTGAAGATGCTCCGCTGTTCC 60


30094R-1.IR_full       61  CGCCCGCAAAACCAGGAAAAAGAGTTGACTATGGGACAAACAACACATTGGAGCTACTGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30094R-1.in silico     61  CGCCCGCAAAACCAGGAAAAAGAGTTGACTATGGGACAAACAACACATTGGAGCTACTGG 120


30094R-1.IR_full       121 AGCGGATTCCCAGCCAGGTGGTGGATCTCAAGCTGGACGATGTGCTGACAGCCGTCAAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30094R-1.in silico     121 AGCGGATTCCCAGCCAGGTGGTGGATCTCAAGCTGGACGATGTGCTGACAGCCGTCAAGG 180


30094R-1.IR_full       181 AAGTGGATAACCTCTGCGACTATCCGCGCTGCGAAAACCAAAACCAGCCTGATGGGCCAA 240
                           |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||
30094R-1.in silico     181 AAGTGGATAACCTCTGCGACTATCCGCGCTGC-AAGACCAAAACCAGCCTGATGGGCCAA 240


30094R-1.IR_full       241 GACTGCCAGCATTGCAAGAAGAGATTCTGCTTCAAGCACGGACTGCCAGAGGTGCACGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
30094R-1.in silico     241 GACTGCCAGCATTGCAAGAAGAGATTCTGCTTCAAGCACGGACTGCCAGAGGTGCACGGG 300


30094R-1.IR_full       301 TGTGGCGAGGAGATTAAGCGGGACGAGCGCAAGAAGTTTCTGCACCCAAAGCCGGCGAAA 360
                           |||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||
30094R-1.in silico     301 TGTGGCGAGGAGATCAAGCGGGACGAGCGCAAGAAGTTTCTGCACCCGAAGCCGGCGAAA 360


30094R-1.IR_full       361 ACCATCAGGCAGGAGGAGGATGTGAAGAATGCGAAAAAGCGTCTGGATGCTAAGTTAAAG 420
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
30094R-1.in silico     361 ACCATCAGGCAGGAGGAGGATGTGAAGAATGCAAAAAAGCGTCTGGATGCTAAGTTAAAG 420


30094R-1.IR_full       421 GAAATGCAGTTGGGGCGCACTCAAAAAGCCACCGGAGGAGGTTCCAAAAA 470
                           ||||||||||||||||||||||||||||||||||||||||||||||||||
30094R-1.in silico     421 GAAATGCAGTTGGGGCGCACTCAAAAAGCCACCGGAGGAGGTTCCAAAAA 470

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   451  NM_166149.1  CG30094-RA (CG30094), mRNA 
0.22   NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0.22   NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_140821.2  CG3819-RA (CG3819), mRNA 
0   NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0   NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0   NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0   10  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 
0   NM_140842.1  CG9629-RA (CG9629), mRNA 
0   NM_135289.2  CG7025-RA (CG7025), mRNA 
0   NM_169339.1  CG12819-RA, transcript variant A (sle), mRNA 
0   NM_169338.1  CG12819-RB, transcript variant B (sle), mRNA 
0   NM_169989.1  CG6028-RB, transcript variant B (CG6028), mRNA 
0   NM_142745.2  CG6028-RA, transcript variant A (CG6028), mRNA 
0   NM_143425.1  CG11900-RA (CG11900), mRNA 
0   NM_079564.3  CG8874-RA, transcript variant A (Fps85D), mRNA 
0   NM_169274.1  CG8874-RB, transcript variant B (Fps85D), mRNA 
0   NM_169275.1  CG8874-RC, transcript variant C (Fps85D), mRNA 
0   NM_079549.2  CG7850-RA (puc), mRNA 
0   NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_143000.1  CG17782-RA (CG17782), mRNA 
0   NM_169622.1  CG31155-RA (Rpb7), mRNA 
0   NM_164966.2  CG6464-RA (salm), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   NM_138984.2  CG5712-RA (ACXD), mRNA 
0   NM_169873.1  CG7535-RB, transcript variant B (GluClalpha), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.