National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3006R-3 
 Symbol Fmo-1  Full Name Flavin-containing monooxygenase 1 
 CG No CG3006  Old CG No CG3006 
 Synonyms DmFMO-1, FMO-1, CG3006, Fmo-1 
 Accession No (Link to NCBI) NM_138015.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCTGGGTTTACAATGAGGCAACAGGGGCGGTCAATGGCATCGATGTCCACAGCAGCATG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TACAAGAACCTACGAACCAACCTGCCCAAGGAGGTAATGGGCTTCCCGGACTTCGAAATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGGGCAAACGAGGCTTCCTATGTGAGATCCGACGAGATCTGCGACTTCCTTAACCAATAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGAACCATTTCGACCTGAAGAAGCACATCAAGTTCGATAGCTATGTGATTCGAGTTTTG 240

                          ||||||||||||||||||||||| | |||||||||||||||| ||||||||||||||||| silico     241 CAGAGGAAAACAAAGTGGCAAGTAC-TTTTCAAAGACTTGGTCACCAACAAGATAGAGTT 300

                          ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     301 CCAGTACTTCGACAAGGTCTTGGTGGCCAATGGCCACTA-CCACACTCCGAATTATAGCC 360

                          |||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| silico     361 AAATTCCGAATATGGAAAGGTTTAAAGGGCAGTT-CCTGCACAGCCACGACTTCAGAAGT 420

                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGGAGGTTTTCGAAGGTAAATCCGTTCTGGTCATTGGAGCTGGTCCCAGTGGCATGGAC 480

3006R-3.IR_full       481 CTGTCGAACATCATTTCCCGAAC 503
                          ||||||||||||||||||||||| silico     481 CTGTCGAACATCATTTCCCGAAC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138015.2  CG3006-RA (Fmo-1), mRNA 
0.2   NM_169801.1  CG31241-RA (CG31241), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_141403.1  CG15185-RA (CG15185), mRNA 
0   NM_137259.2  CG15707-RA (CG15707), mRNA 
0   NM_137042.2  CG6155-RA (Roe1), mRNA 
0   NM_140315.3  CG4357-RA, transcript variant A (Ncc69), mRNA 
0   NM_206344.1  CG4357-RB, transcript variant B (Ncc69), mRNA 
0   NM_057740.3  CG1912-RA (Gycalpha99B), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_138007.2  CG3735-RA (CG3735), mRNA 
0   NM_135540.1  CG5022-RA (CG5022), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   12  27  NM_136373.2  CG3174-RA (Fmo-2), mRNA 
0   NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0   NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0   18  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_136168.1  CG10662-RA (sick), mRNA 
0   NM_140763.1  CG7408-RB (CG7408), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_136517.2  CG8707-RA (CG8707), mRNA 
0   NM_132969.2  CG8918-RA (CG8918), mRNA 
0   NM_142192.2  CG31301-RA (CG31301), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.