National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3006R-1 
 Symbol Fmo-1  Full Name Flavin-containing monooxygenase 1 
 CG No CG3006  Old CG No CG3006 
 Synonyms DmFMO-1, FMO-1, CG3006, Fmo-1 
 Accession No (Link to NCBI) NM_138015.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Fan W, Lam SM, Xin J, Yang X, Liu Z, Liu Y, Wang Y, Shui G, Huang X.
Drosophila TRF2 and TAF9 regulate lipid droplet size and phospholipid fatty acid composition.
PLoS Genet. (2017) 13(3) e1006664 [ PubMed ID = 28273089 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTGGGTTTACAATGAGGCA 
 Primer Seq. 3'
aatctagaggtaccGTTCGGGAAATGATGTTCGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCTGGGTTT ACAATGAGGC AACAGGGGCG GTCAATGGCA TCGATGTCCA CAGCAGCATG 
0061 TACAAGAACC TACGAACCAA CCTGCCCAAG GAGGTAATGG GCTTCCCGGA CTTCGAAATC 
0121 GGGGCAAACG AGGCTTCCTA TGTGAGATCC GACGAGATCT GCGACTTCCT TAACCAATAC 
0181 GCGAACCATT TCGACCTGAA GAAGCACATC AAGTTCGATA GCTATGTGAT TCGAGTTTTG 
0241 CAGAGGAAAA CAAAGTGGCA AGTGCNTTTT CAAAGACTTG GTTACCAACA AGATAGAGTT 
0301 CCAGTACTTC GACAAGGTCT TGGTGGCCAA TGGCCACTAN CCACACTCCG AATTATAGCC 
0361 AAATCCCGAA TATGGAAAGG TTCAAAGGGC AGTTNCCTGC ACAGCCACGA CTTCAGAAGT 
0421 AGGGAAGTTT TCGAAGGTAA ATCCGTTCTG GTCATTGGAG CTGGTCCCAG TGGCATGGAT 
0481 CTGTCGAACA TCATTTCCCG AAC 
 in silico PCR Fragment
0001 ACCTGGGTTT ACAATGAGGC AACAGGGGCG GTCAATGGCA TCGATGTCCA CAGCAGCATG 
0061 TACAAGAACC TACGAACCAA CCTGCCCAAG GAGGTAATGG GCTTCCCGGA CTTCGAAATC 
0121 GGGGCAAACG AGGCTTCCTA TGTGAGATCC GACGAGATCT GCGACTTCCT TAACCAATAC 
0181 GCGAACCATT TCGACCTGAA GAAGCACATC AAGTTCGATA GCTATGTGAT TCGAGTTTTG 
0241 CAGAGGAAAA CAAAGTGGCA AGTAC-TTTT CAAAGACTTG GTCACCAACA AGATAGAGTT 
0301 CCAGTACTTC GACAAGGTCT TGGTGGCCAA TGGCCACTA- CCACACTCCG AATTATAGCC 
0361 AAATTCCGAA TATGGAAAGG TTTAAAGGGC AGTT-CCTGC ACAGCCACGA CTTCAGAAGT 
0421 AGGGAGGTTT TCGAAGGTAA ATCCGTTCTG GTCATTGGAG CTGGTCCCAG TGGCATGGAC 
0481 CTGTCGAACA TCATTTCCCG AAC 
 Assemble Data

3006R-1.IR_full       1   ACCTGGGTTTACAATGAGGCAACAGGGGCGGTCAATGGCATCGATGTCCACAGCAGCATG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3006R-1.in silico     1   ACCTGGGTTTACAATGAGGCAACAGGGGCGGTCAATGGCATCGATGTCCACAGCAGCATG 60


3006R-1.IR_full       61  TACAAGAACCTACGAACCAACCTGCCCAAGGAGGTAATGGGCTTCCCGGACTTCGAAATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3006R-1.in silico     61  TACAAGAACCTACGAACCAACCTGCCCAAGGAGGTAATGGGCTTCCCGGACTTCGAAATC 120


3006R-1.IR_full       121 GGGGCAAACGAGGCTTCCTATGTGAGATCCGACGAGATCTGCGACTTCCTTAACCAATAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3006R-1.in silico     121 GGGGCAAACGAGGCTTCCTATGTGAGATCCGACGAGATCTGCGACTTCCTTAACCAATAC 180


3006R-1.IR_full       181 GCGAACCATTTCGACCTGAAGAAGCACATCAAGTTCGATAGCTATGTGATTCGAGTTTTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3006R-1.in silico     181 GCGAACCATTTCGACCTGAAGAAGCACATCAAGTTCGATAGCTATGTGATTCGAGTTTTG 240


3006R-1.IR_full       241 CAGAGGAAAACAAAGTGGCAAGTGCNTTTTCAAAGACTTGGTTACCAACAAGATAGAGTT 300
                          ||||||||||||||||||||||| | |||||||||||||||| |||||||||||||||||
3006R-1.in silico     241 CAGAGGAAAACAAAGTGGCAAGTAC-TTTTCAAAGACTTGGTCACCAACAAGATAGAGTT 300


3006R-1.IR_full       301 CCAGTACTTCGACAAGGTCTTGGTGGCCAATGGCCACTANCCACACTCCGAATTATAGCC 360
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
3006R-1.in silico     301 CCAGTACTTCGACAAGGTCTTGGTGGCCAATGGCCACTA-CCACACTCCGAATTATAGCC 360


3006R-1.IR_full       361 AAATCCCGAATATGGAAAGGTTCAAAGGGCAGTTNCCTGCACAGCCACGACTTCAGAAGT 420
                          |||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
3006R-1.in silico     361 AAATTCCGAATATGGAAAGGTTTAAAGGGCAGTT-CCTGCACAGCCACGACTTCAGAAGT 420


3006R-1.IR_full       421 AGGGAAGTTTTCGAAGGTAAATCCGTTCTGGTCATTGGAGCTGGTCCCAGTGGCATGGAT 480
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| 
3006R-1.in silico     421 AGGGAGGTTTTCGAAGGTAAATCCGTTCTGGTCATTGGAGCTGGTCCCAGTGGCATGGAC 480


3006R-1.IR_full       481 CTGTCGAACATCATTTCCCGAAC 503
                          |||||||||||||||||||||||
3006R-1.in silico     481 CTGTCGAACATCATTTCCCGAAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138015.2  CG3006-RA (Fmo-1), mRNA 
0.2   NM_169801.1  CG31241-RA (CG31241), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_138222.2  CG12191-RA (dpr20), mRNA 
0   NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_058145.3  CG2707-RA (fs(1)Ya), mRNA 
0   NM_141403.1  CG15185-RA (CG15185), mRNA 
0   NM_137259.2  CG15707-RA (CG15707), mRNA 
0   NM_137042.2  CG6155-RA (Roe1), mRNA 
0   NM_140315.3  CG4357-RA, transcript variant A (Ncc69), mRNA 
0   NM_206344.1  CG4357-RB, transcript variant B (Ncc69), mRNA 
0   NM_057740.3  CG1912-RA (Gycalpha99B), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   NM_132681.1  CG15760-RA (CG15760), mRNA 
0   NM_138007.2  CG3735-RA (CG3735), mRNA 
0   NM_135540.1  CG5022-RA (CG5022), mRNA 
0   NM_001014747.1  CG4211-RC, transcript variant C (nonA), mRNA 
0   NM_078643.2  CG4211-RA, transcript variant A (nonA), mRNA 
0   12  27  NM_136373.2  CG3174-RA (Fmo-2), mRNA 
0   NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0   NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0   18  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_136168.1  CG10662-RA (sick), mRNA 
0   NM_140763.1  CG7408-RB (CG7408), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_136517.2  CG8707-RA (CG8707), mRNA 
0   NM_132969.2  CG8918-RA (CG8918), mRNA 
0   NM_142192.2  CG31301-RA (CG31301), mRNA 
0   NM_078501.2  CG5905-RA, transcript variant A (Nep1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.