National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30054Ra-1 
 Symbol CG30054  Full Name CG30054 
 CG No CG30054  Old CG No CG30054 
 Synonyms CG30054,GNAQ/11/14 
 Accession No (Link to NCBI) NM_165926.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGAGGACAAGCGTGGATACA 
 Primer Seq. 3'
aatctagaggtaccATATTCCGACAGTGCTGCCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGAGGACAA GCGTGGATAC ATCAAGCTGG TTTTTCAGAA CATATTCATG GCCATGCAGT 
0061 CAATGATCAA GGCCATGGAT ATGCTGAAGA TTTCCTACGG TCAGGGAGAG CATAGTGAAC 
0121 TGGCCGATCT GGTGATGAGC ATCGATTACG AGACCGTTAC CACGTTCGAG GATCCATACT 
0181 TGAATGCCAT CAAAACGCTT TGGCACGATG CTGGCATCCA GGAGTGCTAT GATCGTCGTA 
0241 GGGAATATCA GCTGACTGAT TCCACTGAAT ATTTTTTGGG TGACATAGGT CGAATTGAAC 
0301 AGGCTGATTA CTTGCCAACT AATCAGGACA TTCTGCGTGC TCGAGAGCCT ACATTTAATA 
0361 TTACCGTTTA TCCTTTTGAG TTGGATGGCT ATGTACTTAG CATGGTGGAT GTAGCAGGAC 
0421 AGCGAACTGA GAGAAGAAAA TGGATTCACT TTTTTTCGAA TGTAACATCG ATTATATTTT 
0481 TGGCAGCACT GTCGGAATAT  
 in silico PCR Fragment
0001 ACGAGGACAA GCGTGGATAC ATCAAGCTGG TTTTTCAGAA CATATTCATG GCCATGCAGT 
0061 CAATGATCAA GGCCATGGAT ATGCTGAAGA TTTCCTACGG TCAGGGAGAG CATAGTGAAC 
0121 TGGCCGATCT GGTGATGAGC ATCGATTACG AGACCGTTAC CACGTTCGAG GATCCATACT 
0181 TGAATGCCAT CAAAACGCTT TGGCACGATG CTGGCATCCA GGAGTGCTAT GATCGTCGTA 
0241 GGGAATATCA GCTGACTGAT TCCACTGAAT ATTTTTTGGG TGACATAGGT CGAATTGAAC 
0301 AGGCTGATTA CTTGCCAACT AATCAGGACA TTCTGCGTGC TCGAGAGCCT ACATTTAATA 
0361 TTACCGTTTA TCCTTTTGAG TTGGATGGCT ATGTACTTAG CATGGTGGAT GTAGCAGGAC 
0421 AGCGAACTGA GAGAAGAAAA TGGATTCACT TTTTTTCGAA TGTAACATCG ATTATATTTT 
0481 TGGCAGCACT GTCGGAATAT  
 Assemble Data

30054Ra-1.IR full       1   ACGAGGACAAGCGTGGATACATCAAGCTGGTTTTTCAGAACATATTCATGGCCATGCAGT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     1   ACGAGGACAAGCGTGGATACATCAAGCTGGTTTTTCAGAACATATTCATGGCCATGCAGT 60


30054Ra-1.IR full       61  CAATGATCAAGGCCATGGATATGCTGAAGATTTCCTACGGTCAGGGAGAGCATAGTGAAC 120
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     61  CAATGATCAAGGCCATGGATATGCTGAAGATTTCCTACGGTCAGGGAGAGCATAGTGAAC 120


30054Ra-1.IR full       121 TGGCCGATCTGGTGATGAGCATCGATTACGAGACCGTTACCACGTTCGAGGATCCATACT 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     121 TGGCCGATCTGGTGATGAGCATCGATTACGAGACCGTTACCACGTTCGAGGATCCATACT 180


30054Ra-1.IR full       181 TGAATGCCATCAAAACGCTTTGGCACGATGCTGGCATCCAGGAGTGCTATGATCGTCGTA 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     181 TGAATGCCATCAAAACGCTTTGGCACGATGCTGGCATCCAGGAGTGCTATGATCGTCGTA 240


30054Ra-1.IR full       241 GGGAATATCAGCTGACTGATTCCACTGAATATTTTTTGGGTGACATAGGTCGAATTGAAC 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     241 GGGAATATCAGCTGACTGATTCCACTGAATATTTTTTGGGTGACATAGGTCGAATTGAAC 300


30054Ra-1.IR full       301 AGGCTGATTACTTGCCAACTAATCAGGACATTCTGCGTGCTCGAGAGCCTACATTTAATA 360
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     301 AGGCTGATTACTTGCCAACTAATCAGGACATTCTGCGTGCTCGAGAGCCTACATTTAATA 360


30054Ra-1.IR full       361 TTACCGTTTATCCTTTTGAGTTGGATGGCTATGTACTTAGCATGGTGGATGTAGCAGGAC 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     361 TTACCGTTTATCCTTTTGAGTTGGATGGCTATGTACTTAGCATGGTGGATGTAGCAGGAC 420


30054Ra-1.IR full       421 AGCGAACTGAGAGAAGAAAATGGATTCACTTTTTTTCGAATGTAACATCGATTATATTTT 480
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30054Ra-1.in silico     421 AGCGAACTGAGAGAAGAAAATGGATTCACTTTTTTTCGAATGTAACATCGATTATATTTT 480


30054Ra-1.IR full       481 TGGCAGCACTGTCGGAATAT 500
                            ||||||||||||||||||||
30054Ra-1.in silico     481 TGGCAGCACTGTCGGAATAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.