National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30049R-3 
 Symbol CG30049  Full Name CG30049 
 CG No CG30049  Old CG No CG30049 
 Synonyms CG30049 
 Accession No (Link to NCBI) NM_165888.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     1   ATGGCCGACGAGCCACTTAAACCCGGCCAATTTGTGGGCGAGAGAGCGCAGAAAATACTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TACGAACTGGATCGTATCGGACCCAAAGTGGTTGGGAGCACAGCGAACGAGGTGACGACG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     121 GTTGCATTTCTCTTAAACGAGGTGGAAAAGATTAGGAGCGAAATGCGCGG-AGACCTCTT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCACTTGGAGGTGGACGTCCAGCAGCCGACGGGTTCCTATGTGGTGGGAACCATGACCAG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || silico     241 CATTTATCAGGGCATTCAGAATGTGGTCGTCAAGTTGAGCACTGCGAGTTCGAATAG-CT 300

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     301 CATCCTATCTCCTAATCAACAGTCACTTCGACACGAAGCCAGGTAGTCCAGGCGCTGGAG 360

                           ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     361 ATGATGGCACAATGGTTGTAGTTATGCTGGAGGTTCTGCGTCAAATGTCCATTTCCGAGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCGAGTTTATGCATCCAATAGTCTTTTTGTTCAATGGCGCCGAGGAGAATCCTCTACAGG 480

30049R-3.IR_full       481 CCTCCCATGGCTTCATCACCCA 502
                           |||||||||||||||||||||| silico     481 CCTCCCATGGCTTCATCACCCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165888.2  CG30049-RA (CG30049), mRNA 
1.03   31  35  NM_137572.2  CG10062-RA (CG10062), mRNA 
0.41   12  35  65  NM_165889.1  CG30043-RA (CG30043), mRNA 
0   10  17  14  NM_137571.1  CG9416-RA (CG9416), mRNA 
0   13  68  NM_176153.1  CG33013-RB (CG33013), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   13  36  NM_137573.2  CG10073-RA (CG10073), mRNA 
0   29  NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   29  NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   16  38  NM_137569.3  CG11961-RB, transcript variant B (CG11961), mRNA 
0   16  38  NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   14  35  NM_165890.2  CG13160-RA (CG13160), mRNA 
0   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 
0   NM_176505.1  CG33207-RA, transcript variant A (pxb), mRNA 
0   12  46  NM_165887.1  CG30047-RA (CG30047), mRNA 
0   NM_079069.2  CG10023-RA, transcript variant A (Fak56D), mRNA 
0   NM_166352.1  CG10023-RB, transcript variant B (Fak56D), mRNA 
0   NM_166353.1  CG10023-RC, transcript variant C (Fak56D), mRNA 
0   NM_135614.2  CG17134-RA (CG17134), mRNA 
0   16  NM_137574.1  CG10081-RA (CG10081), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   NM_136797.2  CG7737-RA (CG7737), mRNA 
0   NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
0   NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0   NM_164818.1  CG13387-RA (emb), mRNA 
0   NM_142210.1  CG6118-RA (CG6118), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.