National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30049R-2 
 Symbol CG30049  Full Name CG30049 
 CG No CG30049  Old CG No CG30049 
 Synonyms CG30049 
 Accession No (Link to NCBI) NM_165888.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCGACGAGCCACTTAAA 
 Primer Seq. 3'
aatctagaggtaccTGGGTGATGAAGCCATGGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGCCGACG AGCCACTTAA ACCCGGCCAA TTTGTGGCCG AGAGAGCGCA GAAAATACTC 
0061 TACGAACTGG ATCGTATCGG ACCCAAAGTG GTTGGGAGCA CAGCGAACGA GGTGACGACG 
0121 GTTGCATTTC TCTTAAACGA GGTGGAAAAG ATTAGGAGCG AAATGCGCGG NAGACCTCTT 
0181 TCACTTGGAG GTGGACGTCC AGCAGCCGAC GGGTTCCTAT GTGGTGGGAA CCATGACCAG 
0241 CATTTATCAG GGCATTCAGA ATGTGGTCGT CAAGTTGAGC ACTGCGAATT CGAATAGCCT 
0301 CATCCTATCT CCTAATCAAC AGTCACTTCG ACACGAAGCC AGGAAGTCCA GGCGCTGGAG 
0361 ATGATGGAAC AATGGTTGTA GTTATGTTGG AGGTTCTGCG TCAAATGTCC ATTTCCGAGA 
0421 GCGAGTTTAT GCATCCAATA GTCTTTTTGT TCAATGGCGC CGAGGAGAAT CCTCTACAGG 
0481 CCTCCCATGG CTTCATCACC CA 
 in silico PCR Fragment
0001 ATGGCCGACG AGCCACTTAA ACCCGGCCAA TTTGTGGGCG AGAGAGCGCA GAAAATACTC 
0061 TACGAACTGG ATCGTATCGG ACCCAAAGTG GTTGGGAGCA CAGCGAACGA GGTGACGACG 
0121 GTTGCATTTC TCTTAAACGA GGTGGAAAAG ATTAGGAGCG AAATGCGCGG -AGACCTCTT 
0181 TCACTTGGAG GTGGACGTCC AGCAGCCGAC GGGTTCCTAT GTGGTGGGAA CCATGACCAG 
0241 CATTTATCAG GGCATTCAGA ATGTGGTCGT CAAGTTGAGC ACTGCGAGTT CGAATAG-CT 
0301 CATCCTATCT CCTAATCAAC AGTCACTTCG ACACGAAGCC AGGTAGTCCA GGCGCTGGAG 
0361 ATGATGGCAC AATGGTTGTA GTTATGCTGG AGGTTCTGCG TCAAATGTCC ATTTCCGAGA 
0421 GCGAGTTTAT GCATCCAATA GTCTTTTTGT TCAATGGCGC CGAGGAGAAT CCTCTACAGG 
0481 CCTCCCATGG CTTCATCACC CA 
 Assemble Data

30049R-2.IR_full       1   ATGGCCGACGAGCCACTTAAACCCGGCCAATTTGTGGCCGAGAGAGCGCAGAAAATACTC 60
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
30049R-2.in silico     1   ATGGCCGACGAGCCACTTAAACCCGGCCAATTTGTGGGCGAGAGAGCGCAGAAAATACTC 60


30049R-2.IR_full       61  TACGAACTGGATCGTATCGGACCCAAAGTGGTTGGGAGCACAGCGAACGAGGTGACGACG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30049R-2.in silico     61  TACGAACTGGATCGTATCGGACCCAAAGTGGTTGGGAGCACAGCGAACGAGGTGACGACG 120


30049R-2.IR_full       121 GTTGCATTTCTCTTAAACGAGGTGGAAAAGATTAGGAGCGAAATGCGCGGNAGACCTCTT 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
30049R-2.in silico     121 GTTGCATTTCTCTTAAACGAGGTGGAAAAGATTAGGAGCGAAATGCGCGG-AGACCTCTT 180


30049R-2.IR_full       181 TCACTTGGAGGTGGACGTCCAGCAGCCGACGGGTTCCTATGTGGTGGGAACCATGACCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30049R-2.in silico     181 TCACTTGGAGGTGGACGTCCAGCAGCCGACGGGTTCCTATGTGGTGGGAACCATGACCAG 240


30049R-2.IR_full       241 CATTTATCAGGGCATTCAGAATGTGGTCGTCAAGTTGAGCACTGCGAATTCGAATAGCCT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||
30049R-2.in silico     241 CATTTATCAGGGCATTCAGAATGTGGTCGTCAAGTTGAGCACTGCGAGTTCGAATAG-CT 300


30049R-2.IR_full       301 CATCCTATCTCCTAATCAACAGTCACTTCGACACGAAGCCAGGAAGTCCAGGCGCTGGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
30049R-2.in silico     301 CATCCTATCTCCTAATCAACAGTCACTTCGACACGAAGCCAGGTAGTCCAGGCGCTGGAG 360


30049R-2.IR_full       361 ATGATGGAACAATGGTTGTAGTTATGTTGGAGGTTCTGCGTCAAATGTCCATTTCCGAGA 420
                           ||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||
30049R-2.in silico     361 ATGATGGCACAATGGTTGTAGTTATGCTGGAGGTTCTGCGTCAAATGTCCATTTCCGAGA 420


30049R-2.IR_full       421 GCGAGTTTATGCATCCAATAGTCTTTTTGTTCAATGGCGCCGAGGAGAATCCTCTACAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30049R-2.in silico     421 GCGAGTTTATGCATCCAATAGTCTTTTTGTTCAATGGCGCCGAGGAGAATCCTCTACAGG 480


30049R-2.IR_full       481 CCTCCCATGGCTTCATCACCCA 502
                           ||||||||||||||||||||||
30049R-2.in silico     481 CCTCCCATGGCTTCATCACCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165888.2  CG30049-RA (CG30049), mRNA 
1.03   31  35  NM_137572.2  CG10062-RA (CG10062), mRNA 
0.41   12  35  65  NM_165889.1  CG30043-RA (CG30043), mRNA 
0   10  17  14  NM_137571.1  CG9416-RA (CG9416), mRNA 
0   13  68  NM_176153.1  CG33013-RB (CG33013), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 
0   NM_057523.3  CG18412-RA (ph-p), mRNA 
0   13  36  NM_137573.2  CG10073-RA (CG10073), mRNA 
0   29  NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   29  NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   16  38  NM_137569.3  CG11961-RB, transcript variant B (CG11961), mRNA 
0   16  38  NM_166342.1  CG11961-RA, transcript variant A (CG11961), mRNA 
0   14  35  NM_165890.2  CG13160-RA (CG13160), mRNA 
0   NM_166668.1  CG4356-RA, transcript variant A (mAcR-60C), mRNA 
0   NM_079120.2  CG4356-RB, transcript variant B (mAcR-60C), mRNA 
0   NM_176505.1  CG33207-RA, transcript variant A (pxb), mRNA 
0   12  46  NM_165887.1  CG30047-RA (CG30047), mRNA 
0   NM_079069.2  CG10023-RA, transcript variant A (Fak56D), mRNA 
0   NM_166352.1  CG10023-RB, transcript variant B (Fak56D), mRNA 
0   NM_166353.1  CG10023-RC, transcript variant C (Fak56D), mRNA 
0   NM_135614.2  CG17134-RA (CG17134), mRNA 
0   16  NM_137574.1  CG10081-RA (CG10081), mRNA 
0   NM_140184.2  CG7628-RA (CG7628), mRNA 
0   NM_136797.2  CG7737-RA (CG7737), mRNA 
0   NM_080251.2  CG12833-RB, transcript variant B (esn), mRNA 
0   NM_165507.1  CG12833-RA, transcript variant A (esn), mRNA 
0   NM_164818.1  CG13387-RA (emb), mRNA 
0   NM_142210.1  CG6118-RA (CG6118), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.