National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30043R-3 
 Symbol CG30043  Full Name CG30043 
 CG No CG30043  Old CG No CG30043 
 Synonyms CG13161, CG30043 
 Accession No (Link to NCBI) NM_165889.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGAGAATCCCATCGACACTGA 
 Primer Seq. 3'
aatctagaggtaccAGTCGAAATGGCTGTTGAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGAGAATCCC ATCGACACTG AACTAGTCGA ATCCCTTTCG CTGCGAAAAG GATACGTCCG 
0061 CCGGCCGCGA TTGTCCCTGG TACTATGCCC CCTCCTTTCT GCTCCTCTGG CTGGCGCTCT 
0121 TTTATGCCAT CGTGATCCCG CTCTACTACA GACTTCCGGA TAGGTTGACC ATATCCGAGG 
0181 AGTCACACAG GCCAGGAGAA TTCGTGGCCG AGCGGGCACA GCAATATCTG TACACATACG 
0241 ACCGCATTGG ACCCAAAGTA ACTGGCAGCT ATGCGAACGA GGTGACCACG GTTGAGTTCC 
0301 TCGTAAACGA AACGGAAAAG ATTCGTGCAG AGATGCGTAG TGACCTCTAC GACCTCGAAT 
0361 TGGATGTCCA GTCACCAACG GGTGGATACG TGTTCAACGA CATGGTTAAC ATGTATCAGG 
0421 GTATTCACAA TGTGATAGTC AAACTGAGTT CCAAGAGCTC CCAGAGTGAA TCGTACCTGT 
0481 TGCTCAACAG CCATTTCGAC T 
 in silico PCR Fragment
0001 AGAGAATCCC ATCGACACTG AACTAGTCGA ATCCCTTTCG CTGCGAAAAG GATACGTCCG 
0061 CCGGCCGCGA TTGT-CCTGG TACTATGCCC CCTCCTTTCT GCTCCTCTGG CTGGCGCTCT 
0121 TTTATGCCAT CGTGATCCCG CTCTACTACA GACTTCCGGA TAGGTTGACC ATATCCGAGG 
0181 AGTCACACAG GCCAGGAGAA TTCGTGGCCG AGCGGGCACA GCAATATCTG TACACATACG 
0241 ACCGCATTGG ACCCAAAGTA ACTGGCAGCT ATGCGAACGA GGTGACCACG GTTGAGTTCC 
0301 TCGTAAACGA AACGGAAAAG ATTCGTGCAG AGATGCGTAG TGACCTCTAC GACCTCGAAT 
0361 TGGATGTCCA GTCACCAACG GGTGGATACG TATTCAACGA CATGGTTAAC ATGTATCAGG 
0421 GTATTCACAA TGTGATCGTC AAGCTGAGTT CCAAGAGCTC CCAGAGTGAA TCGTACCTGT 
0481 TGCTCAACAG CCATTTCGAC T 
 Assemble Data

30043R-3.IR_full       1   AGAGAATCCCATCGACACTGAACTAGTCGAATCCCTTTCGCTGCGAAAAGGATACGTCCG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     1   AGAGAATCCCATCGACACTGAACTAGTCGAATCCCTTTCGCTGCGAAAAGGATACGTCCG 60


30043R-3.IR_full       61  CCGGCCGCGATTGTCCCTGGTACTATGCCCCCTCCTTTCTGCTCCTCTGGCTGGCGCTCT 120
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     61  CCGGCCGCGATTGT-CCTGGTACTATGCCCCCTCCTTTCTGCTCCTCTGGCTGGCGCTCT 120


30043R-3.IR_full       121 TTTATGCCATCGTGATCCCGCTCTACTACAGACTTCCGGATAGGTTGACCATATCCGAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     121 TTTATGCCATCGTGATCCCGCTCTACTACAGACTTCCGGATAGGTTGACCATATCCGAGG 180


30043R-3.IR_full       181 AGTCACACAGGCCAGGAGAATTCGTGGCCGAGCGGGCACAGCAATATCTGTACACATACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     181 AGTCACACAGGCCAGGAGAATTCGTGGCCGAGCGGGCACAGCAATATCTGTACACATACG 240


30043R-3.IR_full       241 ACCGCATTGGACCCAAAGTAACTGGCAGCTATGCGAACGAGGTGACCACGGTTGAGTTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     241 ACCGCATTGGACCCAAAGTAACTGGCAGCTATGCGAACGAGGTGACCACGGTTGAGTTCC 300


30043R-3.IR_full       301 TCGTAAACGAAACGGAAAAGATTCGTGCAGAGATGCGTAGTGACCTCTACGACCTCGAAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30043R-3.in silico     301 TCGTAAACGAAACGGAAAAGATTCGTGCAGAGATGCGTAGTGACCTCTACGACCTCGAAT 360


30043R-3.IR_full       361 TGGATGTCCAGTCACCAACGGGTGGATACGTGTTCAACGACATGGTTAACATGTATCAGG 420
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
30043R-3.in silico     361 TGGATGTCCAGTCACCAACGGGTGGATACGTATTCAACGACATGGTTAACATGTATCAGG 420


30043R-3.IR_full       421 GTATTCACAATGTGATAGTCAAACTGAGTTCCAAGAGCTCCCAGAGTGAATCGTACCTGT 480
                           |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||
30043R-3.in silico     421 GTATTCACAATGTGATCGTCAAGCTGAGTTCCAAGAGCTCCCAGAGTGAATCGTACCTGT 480


30043R-3.IR_full       481 TGCTCAACAGCCATTTCGACT 501
                           |||||||||||||||||||||
30043R-3.in silico     481 TGCTCAACAGCCATTTCGACT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  11  NM_165889.1  CG30043-RA (CG30043), mRNA 
2.28   11  47  32  NM_176153.1  CG33013-RB (CG33013), mRNA 
0   15  40  NM_165888.2  CG30049-RA (CG30049), mRNA 
0   14  NM_137572.2  CG10062-RA (CG10062), mRNA 
0   NM_141097.2  CG14569-RA (CG14569), mRNA 
0   NM_139936.1  CG13678-RA (CG13678), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_078581.2  CG1500-RA (fw), mRNA 
0   NM_206216.1  CG13591-RB, transcript variant B (Ssl), mRNA 
0   NM_079124.2  CG13591-RA, transcript variant A (Ssl), mRNA 
0   NM_142329.2  CG3590-RA (CG3590), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   NM_139708.1  CG4835-RA (CG4835), mRNA 
0   15  15  NM_176155.1  CG33012-RB, transcript variant B (CG33012), mRNA 
0   15  15  NM_176154.1  CG33012-RA, transcript variant A (CG33012), mRNA 
0   25  NM_165890.2  CG13160-RA (CG13160), mRNA 
0   35  NM_165887.1  CG30047-RA (CG30047), mRNA 
0   NM_168146.1  CG32413-RA (CG32413), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 
0   NM_135967.1  CG13272-RA (CG13272), mRNA 
0   19  NM_078492.2  CG3312-RA, transcript variant A (Rnp4F), mRNA 
0   19  NM_206630.1  CG3312-RB, transcript variant B (Rnp4F), mRNA 
0   NM_135153.2  CG9226-RA (CG9226), mRNA 
0   NM_057317.3  CG11579-RD, transcript variant D (arm), mRNA 
0   NM_057318.3  CG11579-RA, transcript variant A (arm), mRNA 
0   NM_166912.2  CG11579-RC, transcript variant C (arm), mRNA 
0   NM_134273.2  CG11579-RB, transcript variant B (arm), mRNA 
0   NM_206605.1  CG11579-RE, transcript variant E (arm), mRNA 
0   NM_169085.1  CG31548-RA (CG31548), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.