National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3003Ra-4 
 Symbol CG42797  Full Name CG42797 
 CG No CG3003  Old CG No CG3003 
 Synonyms BT058014.1,CG3003,CG3099,CG42797 
 Accession No (Link to NCBI) NM_132346.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGGCAGAAGGAGATGACGAG 
 Primer Seq. 3'
aatctagaggtaccAGTGTTGTGGTTGGCGCACCC 
 Predicted Fragment Size
533 
 IR fragment full Seq
0001 AGGCAGAAGN AGANNNNNNG GAGGAGGAGG AGGAAGAGGA GGACGATGAT GATGATCCCA 
0061 AAGAAGAGGA GGCCTTCTAC GAGGCGCGCA ACGGCAACGA AAGTGACGAG CTGGAACAGG 
0121 CCTTCCAGAG TGTCCTTACC CTGACCAACG ATGTCCATGT GAGTGTCAGC GAAGTGGAGG 
0181 AACATGAANN CGCCCTTGGC ATCGAGAAAT CAGGAGGTGG CAGAGGTGGA GGAGCAGCAG 
0241 CAGCAGCTGG GGGCCTGCGC ACTGNCGCAG CCCAGCGACA GCCTGCNNCA AAGGAGTCCA 
0301 GGGAACCGCG CCACCACCAG NACGCTGCTT TCCANCATAT CTTGCGAGGC NNCGGCCAAT 
0361 AATGCCACCN NCTCGCCGAC CNACTCCTAC AATGGCTGCA TTGGCAGCGA NNNNGNNNNC 
0421 AGTGTNGGNG TNNCGCCCNN CGCAAGNTCC TGNNACCCTG TCGNCNNNAA GCGGNNCTCC 
0481 ACGCCCNTGA GNNNNNNNNN AGAAGAANAC CAAGACGGGT GCGCCAACCA CAACACT 
 in silico PCR Fragment
0001 CAGGCAGAAG GAGATGACGA GGAGGAGGAG GAGGAAGAGG AGGACGATGA TGATGATCCC 
0061 AAAGAAGAGG AGGCCTTCTA CGAGGCGCGC AACGGCAACG AAAGTGACGA GCTGGAACAG 
0121 GCCTTCCAGA GTGCCCTTAC CCTGACCAAC GATGTCCATG TGAGTGTCAG CGAAGTGGAG 
0181 GAACATGAA- CCGCCCTTGG CATCGAGAAA TCAGGAGGTG GCAGAGGTGG AGGAGCAGCA 
0241 GCAGCAGCTG GGGGCCTGCG CACTGCCGCA GCCCAGCGA- AGCCT----- ----GCT-CA 
0301 AAGGAGACCA GGGAACCGCG CCACCACCAG -ACGCTGCTT TCCACCAAAT CTTGCGAGAC 
0361 GCCGGCCAAT AATGCCACGC TCTCGCCGAC CAACTCCTAC AATGGCAGCA TTGGCAGCGA 
0421 CGGCGGCAGC -AGTGTGGGC GGTGGCGCCC GCCGCAAG-T CCTG-GACCC TGTCGCCGCA 
0481 AAGCGGTGGC TCCACGCCCC TGA-GCGGAG CCAAGAAGAA GACCAAGACG GGTGCGCCAA 
0541 CCACAACACT  
 Assemble Data

3003Ra-4.IR full       1   -AGGCAGAAGNAGANNNNNNGGAGGAGGAGGAGGAAGAGGAGGACGATGATGATGATCCC 60
                            ||||||||| |||      ||||||||||||||||||||||||||||||||||||||||
3003Ra-4.in silico     1   CAGGCAGAAGGAGATGACGAGGAGGAGGAGGAGGAAGAGGAGGACGATGATGATGATCCC 60


3003Ra-4.IR full       61  AAAGAAGAGGAGGCCTTCTACGAGGCGCGCAACGGCAACGAAAGTGACGAGCTGGAACAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3003Ra-4.in silico     61  AAAGAAGAGGAGGCCTTCTACGAGGCGCGCAACGGCAACGAAAGTGACGAGCTGGAACAG 120


3003Ra-4.IR full       121 GCCTTCCAGAGTGTCCTTACCCTGACCAACGATGTCCATGTGAGTGTCAGCGAAGTGGAG 180
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
3003Ra-4.in silico     121 GCCTTCCAGAGTGCCCTTACCCTGACCAACGATGTCCATGTGAGTGTCAGCGAAGTGGAG 180


3003Ra-4.IR full       181 GAACATGAANNCGCCCTTGGCATCGAGAAATCAGGAGGTGGCAGAGGTGGAGGAGCAGCA 240
                           |||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||
3003Ra-4.in silico     181 GAACATGAACC-GCCCTTGGCATCGAGAAATCAGGAGGTGGCAGAGGTGGAGGAGCAGCA 240


3003Ra-4.IR full       241 GCAGCAGCTGGGGGCCTGCGCACTGNCGCAGCCCAGCGACAGCCTGCNNCAAAGGAGTCC 300
                           ||||||||||||||||||||||||| ||||||||||||| |||||||   ||||||| ||
3003Ra-4.in silico     241 GCAGCAGCTGGGGGCCTGCGCACTGCCGCAGCCCAGCGA-AGCCTGCTC-AAAGGAGACC 300


3003Ra-4.IR full       301 AGGGAACCGCGCCACCACCAGNACGCTGCTTTCCANCATATCTTGCGAGGCNNCGGCCAA 360
                           |||||||||||||||||||||  |||||||||||| || |||||||||| |  |||||||
3003Ra-4.in silico     301 AGGGAACCGCGCCACCACCAGA-CGCTGCTTTCCACCAAATCTTGCGAGACGCCGGCCAA 360


3003Ra-4.IR full       361 TAATGCCACCNNCTCGCCGACCNACTCCTACAATGGCTGCATTGGCAGCGANNNNGNNNN 420
                           |||||||||   |||||||||| |||||||||||||| |||||||||||||    |    
3003Ra-4.in silico     361 TAATGCCACGCTCTCGCCGACCAACTCCTACAATGGCAGCATTGGCAGCGACGGCGGCAG 420


3003Ra-4.IR full       421 CAGTGTNGGNG-TNNCGCCCNNCGCAAGNTCCTGNNACCCTGTCGNCNNNAAGCGGNN-C 480
                           |||||| || | |  |||||  ||||||  |     ||||||||| |   ||||||   |
3003Ra-4.in silico     421 CAGTGTGGGCGGTGGCGCCCGCCGCAAGTCCT--GGACCCTGTCGCCGCAAAGCGGTGGC 480


3003Ra-4.IR full       481 TCCACGCCCNTGAGNNNNNNNNNAGAAGAANACCAAGACGGGTGCGCCAACCACAACACT 540
                           ||||||||| ||||          |||||| |||||||||||||||||||||||||||||
3003Ra-4.in silico     481 TCCACGCCCCTGAGCGGAGCCAA-GAAGAAGACCAAGACGGGTGCGCCAACCACAACACT 540

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   515  64  167  NM_132346.1  CG3003-RB (CG3003), mRNA 
2.13   11  46  92  NM_080335.2  CG2984-RA (Pp2C1), mRNA 
1.94   10  40  177  265  NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
1.94   10  40  177  265  NM_001014739.1  CG7107-RE, transcript variant E (up), mRNA 
1.94   10  40  177  265  NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
1.94   10  40  177  265  NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
1.94   10  40  177  265  NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
1.94   10  40  177  265  NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
1.55   22  88  164  NM_132012.1  CG15776-RA (CG15776), mRNA 
1.55   67  81  NM_143060.1  CG13647-RA (CG13647), mRNA 
1.16   36  77  NM_131978.1  CG15465-RA (CG15465), mRNA 
1.16   21  81  NM_132908.2  CG4453-RA (Nup153), mRNA 
0.97   21  67  128  NM_058003.3  CG5216-RA (Sir2), mRNA 
0.97   15  31  72  NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0.97   15  31  72  NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
0.97   31  58  NM_132095.2  CG3918-RA (CG3918), mRNA 
0.77   42  143  NM_176185.1  CG8421-RE, transcript variant E (Asph), mRNA 
0.77   42  143  NM_166141.2  CG8421-RD, transcript variant D (Asph), mRNA 
0.77   15  47  NM_139378.2  CG13928-RA (CG13928), mRNA 
0.58   21  56  176  NM_138025.2  CG3121-RA (CG3121), mRNA 
0.58   10  26  43  NM_079441.3  CG8742-RA, transcript variant A (Gyc76C), mRNA 
0.58   10  26  43  NM_001007095.1  CG8742-RC, transcript variant C (Gyc76C), mRNA 
0.58   10  26  43  NM_001007096.1  CG8742-RB, transcript variant B (Gyc76C), mRNA 
0.58   16  35  NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0.58   16  35  NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0.58   31  119  NM_166140.1  CG8421-RA, transcript variant A (Asph), mRNA 
0.58   31  119  NM_079033.2  CG8421-RB, transcript variant B (Asph), mRNA 
0.58   17  56  NM_138041.2  CG4049-RA (CG4049), mRNA 
0.58   12  26  NM_142086.2  CG9649-RA (CG9649), mRNA 
0.38   36  43  59  NM_167309.1  CG32663-RA (CG32663), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.