National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30004R-1 
 Symbol CG30004  Full Name CG30004 
 CG No CG30004  Old CG No CG30004 
 Synonyms CG30004 
 Accession No (Link to NCBI) NM_165693.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTCGGATACCACGTACCTGC 
 Primer Seq. 3'
aatctagaggtaccGACCAGGGATTTGCTAGAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACTCGGATAC CACGTACCTG CTGGGTCGGC GGAGTTCCGG AGAGCGGGTG AATCTGGCGG 
0061 ATGAGATACG AAAGCTATCC GATCACCTGC TCATGCTGGC CGAGATCAAC ACCAAGCTTG 
0121 GGGATGCGAA CAATAACGGG AGCAGCAGTG GAGCGCCTGC TGATCCTCct gctgctgctg 
0181 CTGCTGCTGC TGCTCCTGTG CCAACCTCAA CTGCTCCAGC ATCTGTTGCT CCTTCTGGCA 
0241 GTACTTCTAG TAAAACCTCG GAGATCAGCC AGGAAGGCAA TAGGTGGACC AGCAAAACCA 
0301 CTTCGAGCAG TAGCTGGAAT CGTCCCACTT TGAAAGGAGG ACTCTTCAGC CAGGCCAGCA 
0361 GCAGTTCCCA GAGCCAAAGC ACCTACGATG ACGGAAAGGG CAAGACGAAG ATCAGTTCGC 
0421 TGTCTGTGAG ATTGCAGCAA TCCATCGAGG AAACACCCAA GCTAAGCAAC GGAAATAGCT 
0481 CCTCTAGCAA ATCCCTGGTC  
 in silico PCR Fragment
0001 ACTCGGATAC CACGTACCTG CTGGGTCGGC GGAGTTCCGG AGAGCGGGTG AATCTGGCGG 
0061 ATGAGATACG AAAGCTATCC GATCACCTGC TCATGCTGGC CGAGATCAAC ACCAAGCTTG 
0121 GGGATGCGAA CAATAACGGG AGCAGCAGTG GAGCGCCTGC TGATCCTCCT GCTGCTGCTG 
0181 CTGCTGCTGC TGCTCCTGTG CCAACCTCAA CTGCTCCAGC ATCTGTTGCT CCTTCTGGCA 
0241 GTACTTCTAG TAAAACCTCG GAGATCAGCC AGGAAGGCAA TAGGTGGACC AGCAAAACCA 
0301 CTTCGAGCAG TAGCTGGAAT CGTCCCACTT TGAAAGGAGG ACTCTTCAGC CAGGCCAGCA 
0361 GCAGTTCCCA GAGCCAAAGC ACCTACGATG ACGGAAAGGG CAAGACGAAG ATCAGTTCGC 
0421 TGTCTGTGAG ATTGCAGCAG TCCATCGAGG AAACACCCAA GCTAAGCAAC GGAAATAGCT 
0481 CCTCTAGCAA ATCCCTGGTC  
 Assemble Data

30004R-1.IR_full       1   ACTCGGATACCACGTACCTGCTGGGTCGGCGGAGTTCCGGAGAGCGGGTGAATCTGGCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     1   ACTCGGATACCACGTACCTGCTGGGTCGGCGGAGTTCCGGAGAGCGGGTGAATCTGGCGG 60


30004R-1.IR_full       61  ATGAGATACGAAAGCTATCCGATCACCTGCTCATGCTGGCCGAGATCAACACCAAGCTTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     61  ATGAGATACGAAAGCTATCCGATCACCTGCTCATGCTGGCCGAGATCAACACCAAGCTTG 120


30004R-1.IR_full       121 GGGATGCGAACAATAACGGGAGCAGCAGTGGAGCGCCTGCTGATCCTCCTGCTGCTGCTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     121 GGGATGCGAACAATAACGGGAGCAGCAGTGGAGCGCCTGCTGATCCTCCTGCTGCTGCTG 180


30004R-1.IR_full       181 CTGCTGCTGCTGCTCCTGTGCCAACCTCAACTGCTCCAGCATCTGTTGCTCCTTCTGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     181 CTGCTGCTGCTGCTCCTGTGCCAACCTCAACTGCTCCAGCATCTGTTGCTCCTTCTGGCA 240


30004R-1.IR_full       241 GTACTTCTAGTAAAACCTCGGAGATCAGCCAGGAAGGCAATAGGTGGACCAGCAAAACCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     241 GTACTTCTAGTAAAACCTCGGAGATCAGCCAGGAAGGCAATAGGTGGACCAGCAAAACCA 300


30004R-1.IR_full       301 CTTCGAGCAGTAGCTGGAATCGTCCCACTTTGAAAGGAGGACTCTTCAGCCAGGCCAGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     301 CTTCGAGCAGTAGCTGGAATCGTCCCACTTTGAAAGGAGGACTCTTCAGCCAGGCCAGCA 360


30004R-1.IR_full       361 GCAGTTCCCAGAGCCAAAGCACCTACGATGACGGAAAGGGCAAGACGAAGATCAGTTCGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     361 GCAGTTCCCAGAGCCAAAGCACCTACGATGACGGAAAGGGCAAGACGAAGATCAGTTCGC 420


30004R-1.IR_full       421 TGTCTGTGAGATTGCAGCAATCCATCGAGGAAACACCCAAGCTAAGCAACGGAAATAGCT 480
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
30004R-1.in silico     421 TGTCTGTGAGATTGCAGCAGTCCATCGAGGAAACACCCAAGCTAAGCAACGGAAATAGCT 480


30004R-1.IR_full       481 CCTCTAGCAAATCCCTGGTC 500
                           ||||||||||||||||||||
30004R-1.in silico     481 CCTCTAGCAAATCCCTGGTC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
102.9   496  40  28  74  NM_165693.2  CG30004-RA (CG30004), mRNA 
46.05   222  697  1327  1779  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
46.05   222  697  1327  1779  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
46.05   222  697  1327  1779  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
15.56   75  101  67  158  NM_144114.3  CG14494-RA (CG14494), mRNA 
14.31   69  89  66  112  NM_144133.1  CG13235-RA (CG13235), mRNA 
14.1   68  149  246  406  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
14.1   68  149  246  406  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
12.65   61  81  61  105  NM_136061.1  CG15166-RA (CG15166), mRNA 
12.44   60  238  620  1050  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
12.44   60  238  620  1050  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
12.44   60  192  387  664  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
12.44   60  192  387  664  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
12.24   59  68  45  92  NM_176711.2  CG1543-RB (Tbh), mRNA 
12.03   58  95  155  343  NM_167239.2  CG32677-RA (CG32677), mRNA 
12.03   58  93  179  349  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
10.37   50  183  374  667  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
10.37   50  165  302  515  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
10.37   50  85  97  210  NM_133012.2  CG32560-RA (CG32560), mRNA 
9.95   48  108  208  341  NM_132172.2  CG15478-RA (CG15478), mRNA 
9.95   48  94  134  217  NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
9.75   47  75  114  295  NM_206540.1  CG33334-RA (CG33334), mRNA 
9.75   47  73  60  85  NM_132301.3  CG7065-RA (CG7065), mRNA 
9.54   46  45  59  144  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
9.54   46  45  59  144  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
9.54   46  45  59  144  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
9.33   45  226  503  858  NM_001038734.1  CG16902-RC (Hr4), mRNA 
9.33   45  129  221  378  NM_132569.1  CG11245-RA (CG11245), mRNA 
9.33   45  56  42  87  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
9.33   45  56  42  84  NM_134278.2  CG2621-RC, transcript variant C (sgg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.