National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2750R-1 
 Symbol CG2750  Full Name CG2750 
 CG No CG2750  Old CG No CG2750 
 Synonyms anon-WO0140519.124, CG2750 
 Accession No (Link to NCBI) NM_132559.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCTGGAGGATGAGACTATGC 
 Primer Seq. 3'
aatctagaggtaccGCTGACATATGTTGGTTCGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCTGGAGGA TGAGACTATG CCATCGTTTG AAAATAGTTA TGTATTTTCG CGACGACAGC 
0061 CGACAATGCC AAGCGAGTGC CTAGAGGATG TAAGCCAGCC ATCTTTCGAA AGGAGTAGAT 
0121 CTCGTAGACA GAGTCCAAGA AGGCAATTGA CCATGCCTTC GCAGAACCTT TATGACATAT 
0181 CAGCGCCATC TTTTGGCGAC ACAACTAGGG ATCGAAGTAC CAACGAGTGT CTGGAGGACA 
0241 TATCAATGCC GACATTTGAA GAAGAGGTTT CCAATGTATC CAGAAGCAGA AGTCCGCGAC 
0301 GAAAGAAGAT ATCCAGGAGT GCGCGTAATA CAACTGATAA AGTCAGCTCC AGACGACAGA 
0361 CAAGCGAATG CCTGGATGAT ATGACCATGC CATCGTTCGG AAGATCATCG AGTGCGTCAC 
0421 CGAACCGAAG TCGTCGCCAA ACGCAAAGAT TGATGACAAA GTCAAATATT AACGATATAT 
0481 CCGAACCAAC ATATGTCAGC  
 in silico PCR Fragment
0001 TTCTGGAGGA TGAGACTATG CCATCGTTTG AAAATAGTTA TGTATTTTCG CGACGACAGC 
0061 CGACAATGCC AAGCGAATGC CTAGAGGATG TAAGCCAGCC ATCTTTCGAA AGGAGTAGAT 
0121 CTCGTAGACA AAGTCCAAGA AGGCAATTGA CGATGCCTTC GCAAAACCTT TGTGACATAT 
0181 CAGCGCCATC TTTTGGCGAC ACAACTAGGG ATCGAAGTAC CAACGAGTGT TTGGAGGACA 
0241 TATCAATGCC GACATTTGAA GAAGAGGTTT CAAATGTATC CAGAAGCAGA AGTCCGCGAC 
0301 GGAAGAAGAT ATCCAGGAGT GCGCGTAATA CAACTGATAA AGTCAGCTCC AGACGACAGA 
0361 CAAGCGAATG CCTGGATGAT ATGACCATGC CATCGTTCGG AAGATCATCG AGTGCGTCAC 
0421 CGAACCGAAG TCGTCGCCAA ACGCAAAGAT TGATGACAAA GTCAAATATT AACGATATAT 
0481 CCGAACCAAC ATATGTCAGC  
 Assemble Data

2750R-1.IR_full       1   TTCTGGAGGATGAGACTATGCCATCGTTTGAAAATAGTTATGTATTTTCGCGACGACAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2750R-1.in silico     1   TTCTGGAGGATGAGACTATGCCATCGTTTGAAAATAGTTATGTATTTTCGCGACGACAGC 60


2750R-1.IR_full       61  CGACAATGCCAAGCGAGTGCCTAGAGGATGTAAGCCAGCCATCTTTCGAAAGGAGTAGAT 120
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
2750R-1.in silico     61  CGACAATGCCAAGCGAATGCCTAGAGGATGTAAGCCAGCCATCTTTCGAAAGGAGTAGAT 120


2750R-1.IR_full       121 CTCGTAGACAGAGTCCAAGAAGGCAATTGACCATGCCTTCGCAGAACCTTTATGACATAT 180
                          |||||||||| |||||||||||||||||||| ||||||||||| ||||||| ||||||||
2750R-1.in silico     121 CTCGTAGACAAAGTCCAAGAAGGCAATTGACGATGCCTTCGCAAAACCTTTGTGACATAT 180


2750R-1.IR_full       181 CAGCGCCATCTTTTGGCGACACAACTAGGGATCGAAGTACCAACGAGTGTCTGGAGGACA 240
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
2750R-1.in silico     181 CAGCGCCATCTTTTGGCGACACAACTAGGGATCGAAGTACCAACGAGTGTTTGGAGGACA 240


2750R-1.IR_full       241 TATCAATGCCGACATTTGAAGAAGAGGTTTCCAATGTATCCAGAAGCAGAAGTCCGCGAC 300
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
2750R-1.in silico     241 TATCAATGCCGACATTTGAAGAAGAGGTTTCAAATGTATCCAGAAGCAGAAGTCCGCGAC 300


2750R-1.IR_full       301 GAAAGAAGATATCCAGGAGTGCGCGTAATACAACTGATAAAGTCAGCTCCAGACGACAGA 360
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2750R-1.in silico     301 GGAAGAAGATATCCAGGAGTGCGCGTAATACAACTGATAAAGTCAGCTCCAGACGACAGA 360


2750R-1.IR_full       361 CAAGCGAATGCCTGGATGATATGACCATGCCATCGTTCGGAAGATCATCGAGTGCGTCAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2750R-1.in silico     361 CAAGCGAATGCCTGGATGATATGACCATGCCATCGTTCGGAAGATCATCGAGTGCGTCAC 420


2750R-1.IR_full       421 CGAACCGAAGTCGTCGCCAAACGCAAAGATTGATGACAAAGTCAAATATTAACGATATAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2750R-1.in silico     421 CGAACCGAAGTCGTCGCCAAACGCAAAGATTGATGACAAAGTCAAATATTAACGATATAT 480


2750R-1.IR_full       481 CCGAACCAACATATGTCAGC 500
                          ||||||||||||||||||||
2750R-1.in silico     481 CCGAACCAACATATGTCAGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
101.45  489  51  115  297  NM_132559.1  CG2750-RA (CG2750), mRNA 
0   NM_130525.2  CG14629-RA (CG14629), mRNA 
0   NM_141758.3  CG6544-RA, transcript variant A (fau), mRNA 
0   NM_169360.1  CG6544-RD, transcript variant D (fau), mRNA 
0   NM_169361.1  CG6544-RC, transcript variant C (fau), mRNA 
0   NM_169362.1  CG6544-RB, transcript variant B (fau), mRNA 
0   NM_078705.2  CG1685-RA (pen), mRNA 
0   NM_169967.1  CG31177-RA (CG31177), mRNA 
0   NM_133001.2  CG8289-RA (CG8289), mRNA 
0   NM_140881.2  CG8786-RB (CG8786), mRNA 
0   NM_139424.1  CG11814-RA (CG11814), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 
0   NR_001929.1  CR32314, miscRNA 
0   NM_132567.1  CG15732-RA (CG15732), mRNA 
0   NM_079432.2  CG9750-RA (rept), mRNA 
0   NM_167373.1  CG32629-RA (CG32629), mRNA 
0   10  NM_142623.2  CG5085-RA (Sirt2), mRNA 
0   NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0   NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0   NM_140634.1  CG4680-RA (CG4680), mRNA 
0   NM_132852.1  CG8565-RA (CG8565), mRNA 
0   NM_140045.2  CG4447-RA (CG4447), mRNA 
0   NM_136921.1  CG13162-RA (CG13162), mRNA 
0   NM_140779.2  CG5103-RA (CG5103), mRNA 
0   13  NM_079419.2  CG4059-RB, transcript variant B (ftz-f1), mRNA 
0   NM_167192.1  CG32700-RB, transcript variant B (CG32700), mRNA 
0   NM_167191.1  CG32700-RA, transcript variant A (CG32700), mRNA 
0   NM_138268.1  CG12084-RA (CG12084), mRNA 
0   NM_140794.2  CG4108-RA (Chmp1), mRNA 
0   NM_135441.1  CG3752-RA (Aldh), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.