National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2723R-3 
 Symbol ImpE3  Full Name Ecdysone-inducible gene E3 
 CG No CG2723  Old CG No CG2723 
 Synonyms CG2723, CG11046, Imp-E3, IMP-E3, ImpE3 
 Accession No (Link to NCBI) NM_080169.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTCTAGTGGGTCACCTAGTGG 
 Primer Seq. 3'
aatctagaggtaccGTCGTAGCGCTCGCTTTGAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTCTAGTGGG TCACCTAGTG GATCCAGTGG CGCCGGCTAA CCTACTGACT AGCTATCTGC 
0061 CCGCCTCCAT GCAGGCCTTG GCATACTATA TTGATCTGCT GCAGTACGAG CCACTATCAA 
0121 GCACAACAGT GGAGCCTCCT TTCAGTGCGG ATGAAGAAGG TATGGAATCC ACCACTGCAA 
0181 ATCCGCGCCC ATCCACACCG TTGCCCACGA GGATGAGAAC CACTACCACA AGGCGACCGA 
0241 TTGGAGCAGG TGCGTCTGGA TCTGGTGGCA TGGGCTGGTG GCAGCCGCCA AGTTGGTGGG 
0301 AAACGCCGAA GAGATCATCC ACAACCGAGA GACCCACATC GCCACCCACT GTGCCGCACC 
0361 GTCCGGCAAT TTTTGCACCA ACTGCGCCGC CGGAAAAGTC CCTTGAGGGC AACGATCTAT 
0421 TTGCAGAAAT CAAAGATGAT AGCGACTTTG ATACCCTGCC TTTGTCTTTG ATCCGTGATA 
0481 TTCAAAGCGA GCGCTACGAC  
 in silico PCR Fragment
0001 TTCTAGTGGG TCACCTAGTG GATCCAGTGG CGCCGGCTAA CCTACTGACT AGCTATCTGC 
0061 CCGCCTCCAT GCAGGCCTTG GCATACTATA TTGACCTGCT GCAGTACGAG CCACTATCAA 
0121 GCACAACAGT GGAGCCTCCT TTCAGTGCGG ATGAAGAAGG TATGGAATCC ACCACTGCAA 
0181 ATCCGCGCCC ATCCACACCG TTGCCCACGA GGATGAGAAC CACTACCACA AGGCGACCGA 
0241 TTGGAGCAGG TGCGTCTGGA TCTGGTGGCA TGGGCTGGTG GCAGCCGCCA AGTTGGTGGG 
0301 AAACGCCGAA GAGATCATCC ACAACCGAGA GACCCACATC GCCACCCACT GTGCCGCACC 
0361 GTCCGGCAAT TTTTGCACCA ACTGCGCCGC CGGAAAAGTC CCTTGAGGGC AACGATCTAT 
0421 TTGCAGAAAT CAAAGATGAT AGCGACTTTG ATACCCTGCC TTTGTCTTTG ATCCGTGATA 
0481 TTCAAAGCGA GCGCTACGAC  
 Assemble Data

2723R-3.IR_full       1   TTCTAGTGGGTCACCTAGTGGATCCAGTGGCGCCGGCTAACCTACTGACTAGCTATCTGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     1   TTCTAGTGGGTCACCTAGTGGATCCAGTGGCGCCGGCTAACCTACTGACTAGCTATCTGC 60


2723R-3.IR_full       61  CCGCCTCCATGCAGGCCTTGGCATACTATATTGATCTGCTGCAGTACGAGCCACTATCAA 120
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2723R-3.in silico     61  CCGCCTCCATGCAGGCCTTGGCATACTATATTGACCTGCTGCAGTACGAGCCACTATCAA 120


2723R-3.IR_full       121 GCACAACAGTGGAGCCTCCTTTCAGTGCGGATGAAGAAGGTATGGAATCCACCACTGCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     121 GCACAACAGTGGAGCCTCCTTTCAGTGCGGATGAAGAAGGTATGGAATCCACCACTGCAA 180


2723R-3.IR_full       181 ATCCGCGCCCATCCACACCGTTGCCCACGAGGATGAGAACCACTACCACAAGGCGACCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     181 ATCCGCGCCCATCCACACCGTTGCCCACGAGGATGAGAACCACTACCACAAGGCGACCGA 240


2723R-3.IR_full       241 TTGGAGCAGGTGCGTCTGGATCTGGTGGCATGGGCTGGTGGCAGCCGCCAAGTTGGTGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     241 TTGGAGCAGGTGCGTCTGGATCTGGTGGCATGGGCTGGTGGCAGCCGCCAAGTTGGTGGG 300


2723R-3.IR_full       301 AAACGCCGAAGAGATCATCCACAACCGAGAGACCCACATCGCCACCCACTGTGCCGCACC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     301 AAACGCCGAAGAGATCATCCACAACCGAGAGACCCACATCGCCACCCACTGTGCCGCACC 360


2723R-3.IR_full       361 GTCCGGCAATTTTTGCACCAACTGCGCCGCCGGAAAAGTCCCTTGAGGGCAACGATCTAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     361 GTCCGGCAATTTTTGCACCAACTGCGCCGCCGGAAAAGTCCCTTGAGGGCAACGATCTAT 420


2723R-3.IR_full       421 TTGCAGAAATCAAAGATGATAGCGACTTTGATACCCTGCCTTTGTCTTTGATCCGTGATA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2723R-3.in silico     421 TTGCAGAAATCAAAGATGATAGCGACTTTGATACCCTGCCTTTGTCTTTGATCCGTGATA 480


2723R-3.IR_full       481 TTCAAAGCGAGCGCTACGAC 500
                          ||||||||||||||||||||
2723R-3.in silico     481 TTCAAAGCGAGCGCTACGAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080169.2  CG2723-RA (ImpE3), mRNA 
0   NM_170115.2  CG5977-RA, transcript variant A (spas), mRNA 
0   NM_080709.3  CG8285-RA (boss), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_140989.1  CG13251-RA (CG13251), mRNA 
0   NM_139737.1  CG13287-RA (CG13287), mRNA 
0   NM_169676.1  CG31150-RA (CG31150), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   17  46  NM_167482.3  CG32580-RA (CG32580), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_136846.1  CG13198-RA (CG13198), mRNA 
0   NM_165457.1  CG7849-RA, transcript variant A (CG7849), mRNA 
0   NM_136357.1  CG7849-RB, transcript variant B (CG7849), mRNA 
0   15  NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   15  NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_132432.1  CG2186-RA (CG2186), mRNA 
0   NM_170292.1  CG6386-RB, transcript variant B (ball), mRNA 
0   NM_143251.1  CG6386-RA, transcript variant A (ball), mRNA 
0   NM_169205.1  CG2747-RB, transcript variant B (CG2747), mRNA 
0   NM_141504.1  CG2747-RA, transcript variant A (CG2747), mRNA 
0   NM_139964.2  CG7161-RA (Oseg1), mRNA 
0   NM_135890.4  CG10846-RB, transcript variant B (dyn-p25), mRNA 
0   NM_165097.2  CG10846-RA, transcript variant A (dyn-p25), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   NM_001043220.1  CG34127-RA (CG34127), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.