National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2723R-2 
 Symbol ImpE3  Full Name Ecdysone-inducible gene E3 
 CG No CG2723  Old CG No CG2723 
 Synonyms CG2723, CG11046, Imp-E3, IMP-E3, ImpE3 
 Accession No (Link to NCBI) NM_080169.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTCTAGTGGGTCACCTAGTGGATCCAGTGGCGCCGGCTAACCTACTGACTAGCTATCTGC 60

                          |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| silico     61  CCGCCTCCATGCAGGCCTTGGCATACTATATTGACCTGCTGCAGTACGAGCCACTATCAA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCACAACAGTGGAGCCTCCTTTCAGTGCGGATGAAGAAGGTATGGAATCCACCACTGCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCCGCGCCCATCCACACCGTTGCCCACGAGGATGAGAACCACTACCACAAGGCGACCGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGGAGCAGGTGCGTCTGGATCTGGTGGCATGGGCTGGTGGCAGCCGCCAAGTTGGTGGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAACGCCGAAGAGATCATCCACAACCGAGAGACCCACATCGCCACCCACTGTGCCGCACC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTCCGGCAATTTTTGCACCAACTGCGCCGCCGGAAAAGTCCCTTGAGGGCAACGATCTAT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTGCAGAAATCAAAGATGATAGCGACTTTGATACCCTGCCTTTGTCTTTGATCCGTGATA 480

2723R-2.IR_full       481 TTCAAAGCGAGCGCTACGAC 500
                          |||||||||||||||||||| silico     481 TTCAAAGCGAGCGCTACGAC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080169.2  CG2723-RA (ImpE3), mRNA 
0   NM_170115.2  CG5977-RA, transcript variant A (spas), mRNA 
0   NM_080709.3  CG8285-RA (boss), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_140989.1  CG13251-RA (CG13251), mRNA 
0   NM_139737.1  CG13287-RA (CG13287), mRNA 
0   NM_169676.1  CG31150-RA (CG31150), mRNA 
0   NM_137212.2  CG30089-RA (CG30089), mRNA 
0   NM_166928.1  CG3954-RC, transcript variant C (csw), mRNA 
0   NM_057783.2  CG3954-RB, transcript variant B (csw), mRNA 
0   NM_057782.3  CG3954-RA, transcript variant A (csw), mRNA 
0   NM_079175.2  CG1242-RA (Hsp83), mRNA 
0   17  46  NM_167482.3  CG32580-RA (CG32580), mRNA 
0   NM_142057.2  CG9307-RA (CG9307), mRNA 
0   NM_136846.1  CG13198-RA (CG13198), mRNA 
0   NM_165457.1  CG7849-RA, transcript variant A (CG7849), mRNA 
0   NM_136357.1  CG7849-RB, transcript variant B (CG7849), mRNA 
0   15  NM_206278.1  CG5406-RC, transcript variant C (sif), mRNA 
0   15  NM_079908.2  CG5406-RA, transcript variant A (sif), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_132432.1  CG2186-RA (CG2186), mRNA 
0   NM_170292.1  CG6386-RB, transcript variant B (ball), mRNA 
0   NM_143251.1  CG6386-RA, transcript variant A (ball), mRNA 
0   NM_169205.1  CG2747-RB, transcript variant B (CG2747), mRNA 
0   NM_141504.1  CG2747-RA, transcript variant A (CG2747), mRNA 
0   NM_139964.2  CG7161-RA (Oseg1), mRNA 
0   NM_135890.4  CG10846-RB, transcript variant B (dyn-p25), mRNA 
0   NM_165097.2  CG10846-RA, transcript variant A (dyn-p25), mRNA 
0   NM_141067.2  CG7186-RA (SAK), mRNA 
0   NM_001043220.1  CG34127-RA (CG34127), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.