National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2691R-2 
 Symbol CG2691  Full Name CG2691 
 CG No CG2691  Old CG No CG2691 
 Synonyms CG2691 
 Accession No (Link to NCBI) NM_132678.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGAAGCTAAAGCGCAATGG 
 Primer Seq. 3'
aatctagaggtaccGCAGGAAATACTCTGTAGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGAAGCTA AAGCGCAATG GCAAGGGAAA GACATGGAGC AGAGGCTGAA TCGGCCACCT 
0061 CCAATCCCAC CCAGATGAAG CACCGCATGA AGGCCAAATC GCGATTCTTT CAGCCCAATT 
0121 TAAGTTTGGC TGCAGCCACG ACCACCGGCC TCACCATGGA GGCGGTCCAC AAGCATGAGC 
0181 AGAGTCAGGC CTTTAATGCG GAAACCACAA CGGTTAACGA TGTGGCCGGC AGTTTGAGAA 
0241 GTTTCAAACT GGATGACGAT GATGACGGAA TGTCCGGTTC CGGCACCGCT CCCANCCGGC 
0301 ACCGCCCCCA CCGGCACCAT CAAAACCTTC CAGACCTTCG CCTCCAACTA CAGCGGTTGC 
0361 AGCAACACAT GCTTCCAGAA ACTGGTCACC AGCTTCCGGT CCTCGTCCGC TCTTCACAAG 
0421 GAGATGCTGG CCATTCTGAG CGCCCTCACC GAAATAATCC GCGAGAACGG CGGTGGCGAG 
0481 TCGTCTACAG AGTATTTCNC TNc 
 in silico PCR Fragment
0001 ATCGAAGCTA AAGCGCAATG GCAAGGGAAA GACATGGAGC AGAGGC-GAA TCGGCCACCT 
0061 CCAATCCCAC CCAGATGAAG CACCGCATGA AGGCCAAATC GCGATTCTTT CAGCCCAATT 
0121 TAAGTTTGGC TGCAGCCACG ACCACCGGCC TCACCATGGA GGCGGTCCAC AAGCATGAGC 
0181 AGAGTCAGGC CTTTAATGCG GAAACCACAA CGGTTAACGA TGTGGCCGGC AGTTTGAGAA 
0241 GTTTCAAACT GGATGACGAT GATGACGGAA TGTCCGGTTC CGGCACCGCT CCCA-CCGGC 
0301 ACCGCCCCCA CCGGCACCAT CAAAACCTTC CAGACCTTCG CCTCCAACTA CAGCGGTTGC 
0361 AGCAACACAT GCTTCCAGAA ACTGGTCACC AGCTTCCGGT CCTCGTCCGC TCTTCACAAG 
0421 GAGATGCTGG CCATTCTGAG CGCCCTCACC GAAATAATCC GCGAGAACGG CGGTGGCGAG 
0481 TCGTCTACAG AGTATTTC-C TGC 
 Assemble Data

2691R-2.IR_full       1   ATCGAAGCTAAAGCGCAATGGCAAGGGAAAGACATGGAGCAGAGGCTGAATCGGCCACCT 60
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
2691R-2.in silico     1   ATCGAAGCTAAAGCGCAATGGCAAGGGAAAGACATGGAGCAGAGGC-GAATCGGCCACCT 60


2691R-2.IR_full       61  CCAATCCCACCCAGATGAAGCACCGCATGAAGGCCAAATCGCGATTCTTTCAGCCCAATT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     61  CCAATCCCACCCAGATGAAGCACCGCATGAAGGCCAAATCGCGATTCTTTCAGCCCAATT 120


2691R-2.IR_full       121 TAAGTTTGGCTGCAGCCACGACCACCGGCCTCACCATGGAGGCGGTCCACAAGCATGAGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     121 TAAGTTTGGCTGCAGCCACGACCACCGGCCTCACCATGGAGGCGGTCCACAAGCATGAGC 180


2691R-2.IR_full       181 AGAGTCAGGCCTTTAATGCGGAAACCACAACGGTTAACGATGTGGCCGGCAGTTTGAGAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     181 AGAGTCAGGCCTTTAATGCGGAAACCACAACGGTTAACGATGTGGCCGGCAGTTTGAGAA 240


2691R-2.IR_full       241 GTTTCAAACTGGATGACGATGATGACGGAATGTCCGGTTCCGGCACCGCTCCCANCCGGC 300
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
2691R-2.in silico     241 GTTTCAAACTGGATGACGATGATGACGGAATGTCCGGTTCCGGCACCGCTCCCA-CCGGC 300


2691R-2.IR_full       301 ACCGCCCCCACCGGCACCATCAAAACCTTCCAGACCTTCGCCTCCAACTACAGCGGTTGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     301 ACCGCCCCCACCGGCACCATCAAAACCTTCCAGACCTTCGCCTCCAACTACAGCGGTTGC 360


2691R-2.IR_full       361 AGCAACACATGCTTCCAGAAACTGGTCACCAGCTTCCGGTCCTCGTCCGCTCTTCACAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     361 AGCAACACATGCTTCCAGAAACTGGTCACCAGCTTCCGGTCCTCGTCCGCTCTTCACAAG 420


2691R-2.IR_full       421 GAGATGCTGGCCATTCTGAGCGCCCTCACCGAAATAATCCGCGAGAACGGCGGTGGCGAG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2691R-2.in silico     421 GAGATGCTGGCCATTCTGAGCGCCCTCACCGAAATAATCCGCGAGAACGGCGGTGGCGAG 480


2691R-2.IR_full       481 TCGTCTACAGAGTATTTCNCTNC 503
                          |||||||||||||||||| || |
2691R-2.in silico     481 TCGTCTACAGAGTATTTC-CTGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  10  NM_132678.2  CG2691-RA (CG2691), mRNA 
0.41   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   13  NM_142078.1  CG12402-RA (CG12402), mRNA 
0   NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_140625.2  CG4818-RA (CG4818), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
0   NM_206099.1  CG8878-RB, transcript variant B (CG8878), mRNA 
0   NM_136889.2  CG8878-RA, transcript variant A (CG8878), mRNA 
0   NM_137618.1  CG9864-RA (CG9864), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   NM_132130.1  CG12796-RA (CG12796), mRNA 
0   NM_078583.2  CG2559-RA (Lsp1alpha), mRNA 
0   NM_080012.2  CG4201-RA (ird5), mRNA 
0   NM_137927.1  CG9871-RA (CG9871), mRNA 
0   NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
0   NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
0   NM_141157.2  CG11238-RA (l(3)04053), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_131939.4  CG17592-RB, transcript variant B (Usf), mRNA 
0   NM_167010.1  CG17592-RA, transcript variant A (Usf), mRNA 
0   NM_139839.3  CG32381-RA (unc-13-4A), mRNA 
0   35  NM_143342.1  CG5514-RB, transcript variant B (CG5514), mRNA 
0   35  NM_170361.1  CG5514-RA, transcript variant A (CG5514), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.