National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2540R-3 
 Symbol CG2540  Full Name CG2540 
 CG No CG2540  Old CG No CG2540 
 Synonyms CG2540 
 Accession No (Link to NCBI) NM_132590.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTGGACTTCCTGACGGAG 
 Primer Seq. 3'
aatctagaggtaccAAGCTGCAGCGCTCATACCCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGTTGGACT TCCTGACGGA GCTGCGAAGC AGTGGTTCTA GGGCGGATCA GCTGCCCGGC 
0061 AACATATACA CCGAGTTCTT CGCGAACGTT ATCGAGGAGC CCAGGGAACA TGGATGCAAG 
0121 TCAGCGGATC AGGATTTTAC ACAAGGATTC TNCCATGCTA CGCACTTTCG ATACCGAAAA 
0181 TAGCAATCAA TTGGAGCCNC CGGCGGCCAC GGATGCGGAT GTCTGGATCT TTGGCTATGG 
0241 GTCGTTGGTA TGGAAGACGG ACTTCCCGTA CATAGACCGA CGACGCGGCT TCGTTTGGGG 
0301 ATTCAAGCGT CGCTTCTACC AGCACAGCAT CGATCACCGG GGTATTCCCG AACGTCCTGG 
0361 TCGCGTGGTC ACCCTGCTGC CAGGCGATCC CGCCCAGGAT CGTGTCTATG GCGTCGCCTA 
0421 TCGCATAGCT GCTAGTCAAA AGGGTGCTGT GTTGGACCAT CTGGATTACC GGGAGAAGAA 
0481 CGGGTATGAN CGCTGCAGCT T 
 in silico PCR Fragment
0001 ATGTTGGACT TCCTGACGGA GCTGCGAAGC AGTGGTTCTA GGGCGGATCA GCTGCCCGGC 
0061 AACATATACA CCGAGTTCTT CGCGAACGTT ATCGAGGAGC CCAGGGAACA TGGATGCAAG 
0121 TCAGCGGATC AGGATTTTAC ACAAGGATTC T-CCATGCTA CGCACTTTCG ATACCGAAAA 
0181 TAGCAATCAA TTGGAGCCGC CGGCGGCCAC GGATGCGGAT GTCTGGATCT TTGGCTATGG 
0241 GTCGTTGGTA TGGAAGACGG ACTTCCCGTA CATAGACCGA CGACGCGGCT TCGTTTGGGG 
0301 ATTCAAGCGT CGCTTCTACC AGCACAGCAT CGATCACCGG GGTATTCCCG AACGTCCTGG 
0361 TCGCGTGGTC ACCCTGCTGC CAGGCGATCC CGCCCAGGAT CGTGTCTATG GCGTCGCCTA 
0421 TCGCATAGCT GCTAGTCAAA AGGGTGCTGT GTTGGACCAT CTGGATTACC GGGAGAAGAA 
0481 CGGGTATGAG CGCTGCAGCT T 
 Assemble Data

2540R-3.IR_full        1   TGTTGGACTTCCTGACGGAGCTGCGAAGCAGTGGTTCTAGGGCGGATCAGCTGCCCGGC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico      1   TGTTGGACTTCCTGACGGAGCTGCGAAGCAGTGGTTCTAGGGCGGATCAGCTGCCCGGC 59


2540R-3.IR_full       61  AACATATACACCGAGTTCTTCGCGAACGTTATCGAGGAGCCCAGGGAACATGGATGCAAG 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     61  AACATATACACCGAGTTCTTCGCGAACGTTATCGAGGAGCCCAGGGAACATGGATGCAAG 119


2540R-3.IR_full       121 TCAGCGGATCAGGATTTTACACAAGGATTCTNCCATGCTACGCACTTTCGATACCGAAAA 179
                          ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
2540R-3.in silico     121 TCAGCGGATCAGGATTTTACACAAGGATTCT-CCATGCTACGCACTTTCGATACCGAAAA 179


2540R-3.IR_full       181 TAGCAATCAATTGGAGCCNCCGGCGGCCACGGATGCGGATGTCTGGATCTTTGGCTATGG 239
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     181 TAGCAATCAATTGGAGCCGCCGGCGGCCACGGATGCGGATGTCTGGATCTTTGGCTATGG 239


2540R-3.IR_full       241 GTCGTTGGTATGGAAGACGGACTTCCCGTACATAGACCGACGACGCGGCTTCGTTTGGGG 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     241 GTCGTTGGTATGGAAGACGGACTTCCCGTACATAGACCGACGACGCGGCTTCGTTTGGGG 299


2540R-3.IR_full       301 ATTCAAGCGTCGCTTCTACCAGCACAGCATCGATCACCGGGGTATTCCCGAACGTCCTGG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     301 ATTCAAGCGTCGCTTCTACCAGCACAGCATCGATCACCGGGGTATTCCCGAACGTCCTGG 359


2540R-3.IR_full       361 TCGCGTGGTCACCCTGCTGCCAGGCGATCCCGCCCAGGATCGTGTCTATGGCGTCGCCTA 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     361 TCGCGTGGTCACCCTGCTGCCAGGCGATCCCGCCCAGGATCGTGTCTATGGCGTCGCCTA 419


2540R-3.IR_full       421 TCGCATAGCTGCTAGTCAAAAGGGTGCTGTGTTGGACCATCTGGATTACCGGGAGAAGAA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2540R-3.in silico     421 TCGCATAGCTGCTAGTCAAAAGGGTGCTGTGTTGGACCATCTGGATTACCGGGAGAAGAA 479


2540R-3.IR_full       481 CGGGTATGANCGCTGCAGCTT 500
                          ||||||||| |||||||||||
2540R-3.in silico     481 CGGGTATGAGCGCTGCAGCTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132590.1  CG2540-RA (CG2540), mRNA 
0   NM_140206.1  CG6149-RA (CG6149), mRNA 
0   NM_001014474.2  CG33531-RA (Ddr), mRNA 
0   NM_139806.1  CG9948-RA (CG9948), mRNA 
0   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0   NM_078638.2  CG9908-RA, transcript variant A (disco), mRNA 
0   NM_001038758.1  CG9908-RB, transcript variant B (disco), mRNA 
0   NM_139458.2  CG1317-RB (CG1317), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_168443.1  CG11799-RA, transcript variant A (Mnf), mRNA 
0   NM_140183.1  CG11799-RE, transcript variant E (Mnf), mRNA 
0   NM_168446.1  CG11799-RD, transcript variant D (Mnf), mRNA 
0   NM_168444.1  CG11799-RB, transcript variant B (Mnf), mRNA 
0   NM_168445.1  CG11799-RC, transcript variant C (Mnf), mRNA 
0   NM_141745.3  CG6345-RA (CG6345), mRNA 
0   NM_080125.2  CG4399-RB (east), mRNA 
0   NR_001355.1  CG4399-RB (east), mRNA, mRNA 
0   NM_165974.2  CG4654-RB, transcript variant B (Dp), mRNA 
0   NM_057691.3  CG4654-RA, transcript variant A (Dp), mRNA 
0   13  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_079090.2  CG3668-RA (fd59A), mRNA 
0   NM_168497.1  CG32105-RB (CG32105), mRNA 
0   NM_135859.1  CG17341-RA (CG17341), mRNA 
0   NM_137311.2  CG8566-RD (unc-104), mRNA 
0   NM_167411.1  CG9413-RB, transcript variant B (CG9413), mRNA 
0   NM_132738.1  CG9413-RA, transcript variant A (CG9413), mRNA 
0   NM_130669.2  CG2701-RA (CG2701), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.