National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2471R-3 
 Symbol Sclp  Full Name Sclp 
 CG No CG2471  Old CG No CG2471 
 Synonyms CT8171, Sclp, CG2471, dSCLP 
 Accession No (Link to NCBI) NM_132542.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGGCCTTTTGGCAACGAC 
 Primer Seq. 3'
aatctagaggtaccTTGGTTAGCGCAGACAAGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCGGCCTT TTgGNAACGA CATAACAAAC ATCCCGAACg GTGGTAATAA TGGTGGTAAT 
0061 AATGGTGGTA ATAATGGCNA CAACGATCCC AACGACGGCA ACGACAACCG GAACACGAAC 
0121 ATATCCAGTG AGGATCCCAG CGAGGAGTCC GGACTATCGG ACGATCCGAG TATTCCGCCG 
0181 CATATAGCGA GNAATCGGCG GAATCGTTAC CTGCCCCCCG ATCGCTGGAC AAGGAGTTAT 
0241 CCGGGTGGTT CAGCGTTGCG ANAGACGCCA AGGAGAACCA CAAACTGGAT CTTTCAAGTT 
0301 GTGAACTGAT GCAAATACCA GATGCGGTAT ATCATCTTAT GCGAAACACA GAGTTGATCA 
0361 CCTGCAATCT CAGTGGCAAT GTGCTCAAAA GCGTTTCGCC CAAGTTTTCG CAAAAGTTTA 
0421 GTACCATCAC AGATCTTAAT CTGTCACACA ACAAACTGTC GAGGCTGCCA GAAGAATTCG 
0481 CCAGCTTGTC TGCGCTAACC AA 
 in silico PCR Fragment
0001 ATGCGGCCTT TTGGCAACGA CATAACAAAC ATCCCGAACG GTGGTAATAA TGGTGGTAAT 
0061 AATGGTGGTA ATAATGGCAA CAACGATCCC AACGACGGCA ACGACAACCG GAACACGAAC 
0121 ATATCCAGTG AGGATCCCAG CGAGGAGTCC GGACTATCGG ACGATCCGAG TATTCCGCCG 
0181 CATATAGCGA G-AATCGGCG GAATCGTTAC CTGCCCCCCG ATCGCTGGAC AAGGAGTTAT 
0241 CCGGGTGGTT CAGCGTTGCG A-AGACGCCA AGGAGAACCA CAAACTGGAT CTTTCAAGTT 
0301 GTGAACTGAT GCAAATACCA GATGCGGTAT ATCATCTTAT GCGAAACACA GAGTTGATCA 
0361 CCTGCAATCT CAGTGGCAAT GTGCTCAAAA GCGTTTCGCC CAAGTTTTCG CAAAAGTTTA 
0421 GTACCATCAC AGATCTTAAT CTGTCACACA ACAAACTGTC GAGGCTGCCA GAAGAATTCG 
0481 CCAGCTTGTC TGCGCTAACC AA 
 Assemble Data

2471R-3.IR_full       1   ATGCGGCCTTTTGGNAACGACATAACAAACATCCCGAACGGTGGTAATAATGGTGGTAAT 60
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     1   ATGCGGCCTTTTGGCAACGACATAACAAACATCCCGAACGGTGGTAATAATGGTGGTAAT 60


2471R-3.IR_full       61  AATGGTGGTAATAATGGCNACAACGATCCCAACGACGGCAACGACAACCGGAACACGAAC 120
                          |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     61  AATGGTGGTAATAATGGCAACAACGATCCCAACGACGGCAACGACAACCGGAACACGAAC 120


2471R-3.IR_full       121 ATATCCAGTGAGGATCCCAGCGAGGAGTCCGGACTATCGGACGATCCGAGTATTCCGCCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     121 ATATCCAGTGAGGATCCCAGCGAGGAGTCCGGACTATCGGACGATCCGAGTATTCCGCCG 180


2471R-3.IR_full       181 CATATAGCGAGNAATCGGCGGAATCGTTACCTGCCCCCCGATCGCTGGACAAGGAGTTAT 240
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     181 CATATAGCGAG-AATCGGCGGAATCGTTACCTGCCCCCCGATCGCTGGACAAGGAGTTAT 240


2471R-3.IR_full       241 CCGGGTGGTTCAGCGTTGCGANAGACGCCAAGGAGAACCACAAACTGGATCTTTCAAGTT 300
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     241 CCGGGTGGTTCAGCGTTGCGA-AGACGCCAAGGAGAACCACAAACTGGATCTTTCAAGTT 300


2471R-3.IR_full       301 GTGAACTGATGCAAATACCAGATGCGGTATATCATCTTATGCGAAACACAGAGTTGATCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     301 GTGAACTGATGCAAATACCAGATGCGGTATATCATCTTATGCGAAACACAGAGTTGATCA 360


2471R-3.IR_full       361 CCTGCAATCTCAGTGGCAATGTGCTCAAAAGCGTTTCGCCCAAGTTTTCGCAAAAGTTTA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     361 CCTGCAATCTCAGTGGCAATGTGCTCAAAAGCGTTTCGCCCAAGTTTTCGCAAAAGTTTA 420


2471R-3.IR_full       421 GTACCATCACAGATCTTAATCTGTCACACAACAAACTGTCGAGGCTGCCAGAAGAATTCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2471R-3.in silico     421 GTACCATCACAGATCTTAATCTGTCACACAACAAACTGTCGAGGCTGCCAGAAGAATTCG 480


2471R-3.IR_full       481 CCAGCTTGTCTGCGCTAACCAA 502
                          ||||||||||||||||||||||
2471R-3.in silico     481 CCAGCTTGTCTGCGCTAACCAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
103.31  498  10  NM_132542.2  CG2471-RA (CG2471), mRNA 
0   NM_166223.1  CG6556-RA (cnk), mRNA 
0   NM_134966.2  CG3964-RA, transcript variant A (CG3964), mRNA 
0   NM_164562.1  CG3964-RB, transcript variant B (CG3964), mRNA 
0   NM_132084.2  CG12219-RA (CG12219), mRNA 
0   NM_205948.1  CG15828-RB, transcript variant B (CG15828), mRNA 
0   NM_135460.1  CG15828-RA, transcript variant A (CG15828), mRNA 
0   NM_132667.1  CG15756-RA (CG15756), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   13  NM_166757.1  CG1710-RC, transcript variant C (Hcf), mRNA 
0   13  NM_166756.1  CG1710-RB, transcript variant B (Hcf), mRNA 
0   13  NM_079882.2  CG1710-RA, transcript variant A (Hcf), mRNA 
0   13  NM_205873.1  CG1710-RD, transcript variant D (Hcf), mRNA 
0   NM_142527.2  CG5629-RB, transcript variant B (CG5629), mRNA 
0   NM_143745.2  CG18389-RA (Eip93F), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   NM_080135.2  CG11217-RA (CanB2), mRNA 
0   NM_079357.2  CG7250-RA (Toll-6), mRNA 
0   NM_078587.2  CG4353-RC, transcript variant C (hep), mRNA 
0   NM_167346.1  CG4353-RA, transcript variant A (hep), mRNA 
0   NM_142535.2  CG11703-RA (CG11703), mRNA 
0   NM_136207.2  CG9316-RA (CG9316), mRNA 
0   NM_170028.1  CG31159-RA (CG31159), mRNA 
0   NM_143435.2  CG2321-RA (CG2321), mRNA 
0   NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_141465.2  CG14598-RA (CG14598), mRNA 
0   NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   NM_143089.2  CG11849-RA (dan), mRNA 
0   NM_001043081.1  CG11798-RD, transcript variant D (chn), mRNA 
0   NM_130555.1  CG14772-RA (CG14772), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.