National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2368R-2 
 Symbol psq  Full Name pipsqueak 
 CG No CG2368  Old CG No CG2368 
 Synonyms psq, eyeful, CG2368, Psq, BTB-V, pip, psq-1, psk, zep, BtbV 
 Accession No (Link to NCBI) NM_165790.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGCGAGGATCTCTCCTTTG 
 Primer Seq. 3'
aatctagaggtaccTTGCTGCTGGGCATGCACCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCGCGAGGA TCTCTCCTTT GTGGACGTCA CTCTGTCCTG CGAGCATGGA TCCCTCAAGG 
0061 CGCACAAGGT CGTCCTGTCC GCCTGTTCGA CGTATTTCCA AAAACTACTG CTCGAGAATC 
0121 CGTGCAAACA TCCCACAATT ATCCTTCCCG CCGACATTAT CTTCACCGAC CTGAAAACGA 
0181 TCATCGATTT TGTTTATCGT GGTGAAATCG ACGTCACCGA ATCGGAATTA CAGGGCCTCT 
0241 TGCGCACCGC CGAGCAGCTA AAGATCAAGG GACTCTGCGA AACCGCCGAG AACGCGGATG 
0301 ACCTGAACGA CGCGGCCACT GCAACGATCA CAGTTTCAGA GAACATACAG CAGGCGGTCG 
0361 TTGGCAATAT AGTGAACGCC GCCATAGTTC CCGGAGCTCC GTCGCCCTCC TTGGAACAGC 
0421 AGCAGCAACA CCACCAACAG CAGCAACAGC AGCAGGCGCA GGAGCAGCAC CAGCAACAGC 
0481 AGGTGCATGC CCAGCAGCAA  
 in silico PCR Fragment
0001 TGCGCGAGGA TCTCTCCTTT GTGGACGTCA CTCTGTCCTG CGAGCATGGA TCCCTCAAGG 
0061 CGCACAAGGT CGTCCTGTCC GCCTGTTCGA CGTATTTCCA AAAACTACTG CTCGAGAATC 
0121 CGTGCAAACA TCCCACAATT ATCCTTCCCG CCGACATTAT CTTCACCGAC CTGAAAACGA 
0181 TCATCGATTT TGTTTATCGT GGTGAAATCG ACGTCACCGA ATCGGAATTA CAGGGCCTCT 
0241 TGCGCACCGC CGAGCAGCTA AAGATCAAGG GACTCTGCGA AACCGCCGAG AACGCGGATG 
0301 ACCTGAACGA CGCGGCCACT GCAACGATCA CAGTTTCAGA GAACATACAG CAGGCGGTCG 
0361 TTGGCAATAT AGTGAACGCC GCCATAGTTC CCGGAGCTCC GTCGCCCTCC TTGGAACAGC 
0421 AGCAGCAACA CCACCAACAG CAGCAACAGC AGCAGGCGCA GGAGCAGCAC CAGCAACAGC 
0481 AGGTGCATGC CCAGCAGCAA  
 Assemble Data

2368R-2.IR_full       1   TGCGCGAGGATCTCTCCTTTGTGGACGTCACTCTGTCCTGCGAGCATGGATCCCTCAAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     1   TGCGCGAGGATCTCTCCTTTGTGGACGTCACTCTGTCCTGCGAGCATGGATCCCTCAAGG 60


2368R-2.IR_full       61  CGCACAAGGTCGTCCTGTCCGCCTGTTCGACGTATTTCCAAAAACTACTGCTCGAGAATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     61  CGCACAAGGTCGTCCTGTCCGCCTGTTCGACGTATTTCCAAAAACTACTGCTCGAGAATC 120


2368R-2.IR_full       121 CGTGCAAACATCCCACAATTATCCTTCCCGCCGACATTATCTTCACCGACCTGAAAACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     121 CGTGCAAACATCCCACAATTATCCTTCCCGCCGACATTATCTTCACCGACCTGAAAACGA 180


2368R-2.IR_full       181 TCATCGATTTTGTTTATCGTGGTGAAATCGACGTCACCGAATCGGAATTACAGGGCCTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     181 TCATCGATTTTGTTTATCGTGGTGAAATCGACGTCACCGAATCGGAATTACAGGGCCTCT 240


2368R-2.IR_full       241 TGCGCACCGCCGAGCAGCTAAAGATCAAGGGACTCTGCGAAACCGCCGAGAACGCGGATG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     241 TGCGCACCGCCGAGCAGCTAAAGATCAAGGGACTCTGCGAAACCGCCGAGAACGCGGATG 300


2368R-2.IR_full       301 ACCTGAACGACGCGGCCACTGCAACGATCACAGTTTCAGAGAACATACAGCAGGCGGTCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     301 ACCTGAACGACGCGGCCACTGCAACGATCACAGTTTCAGAGAACATACAGCAGGCGGTCG 360


2368R-2.IR_full       361 TTGGCAATATAGTGAACGCCGCCATAGTTCCCGGAGCTCCGTCGCCCTCCTTGGAACAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     361 TTGGCAATATAGTGAACGCCGCCATAGTTCCCGGAGCTCCGTCGCCCTCCTTGGAACAGC 420


2368R-2.IR_full       421 AGCAGCAACACCACCAACAGCAGCAACAGCAGCAGGCGCAGGAGCAGCACCAGCAACAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2368R-2.in silico     421 AGCAGCAACACCACCAACAGCAGCAACAGCAGCAGGCGCAGGAGCAGCACCAGCAACAGC 480


2368R-2.IR_full       481 AGGTGCATGCCCAGCAGCAA 500
                          ||||||||||||||||||||
2368R-2.in silico     481 AGGTGCATGCCCAGCAGCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  24  95  398  NM_001014517.1  CG2368-RL, transcript variant L (psq), mRNA 
100.41  484  24  95  398  NM_001014520.1  CG2368-RI, transcript variant I (psq), mRNA 
100.41  484  24  95  398  NM_078962.2  CG2368-RB, transcript variant B (psq), mRNA 
100.41  484  24  95  398  NM_165790.1  CG2368-RA, transcript variant A (psq), mRNA 
100.41  484  24  95  398  NM_206086.1  CG2368-RC, transcript variant C (psq), mRNA 
52.48   253  25  97  398  NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
52.48   253  25  97  398  NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 
52.48   253  25  97  398  NM_176141.1  CG2368-RF, transcript variant F (psq), mRNA 
52.48   253  25  97  398  NM_001014518.1  CG2368-RK, transcript variant K (psq), mRNA 
52.07   251  26  96  398  NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
52.07   251  26  96  398  NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
52.07   251  26  96  398  NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
3.73   18  118  797  2810  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
3.73   18  118  797  2810  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
3.73   18  118  797  2810  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
2.9   14  27  147  506  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
2.28   11  28  105  156  NM_167617.1  CG32548-RB, transcript variant B (CG32548), mRNA 
2.28   11  27  98  140  NM_133065.2  CG32548-RC, transcript variant C (CG32548), mRNA 
2.28   11  21  58  207  NM_139827.1  CG17742-RA (CG17742), mRNA 
1.86   30  149  487  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
1.86   30  149  487  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
1.86   28  127  388  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
1.86   22  141  450  NM_078601.2  CG9533-RA (rut), mRNA 
1.65   16  69  146  NM_137027.1  CG4744-RA (CG4744), mRNA 
1.45   32  135  409  NM_132004.2  CG4136-RA (CG4136), mRNA 
1.45   17  125  378  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
1.45   17  125  378  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
1.45   17  96  299  NM_167189.2  CG32705-RA (CG32705), mRNA 
1.24   34  106  404  NM_140155.2  CG7958-RA, transcript variant A (tna), mRNA 
1.24   34  102  394  NM_168422.1  CG7958-RB, transcript variant B (tna), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.