National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2330R-2 
 Symbol Neurochondrin  Full Name Neurochondrin 
 CG No CG2330  Old CG No CG2330 
 Synonyms Neurochondrin, CG2330 
 Accession No (Link to NCBI) NM_141401.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGAGCCATCCCCAAGATGTC 
 Primer Seq. 3'
aatctagaggtaccCCGCCTGCTTGAAGGTGGTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGAGCCATC CCCAAGATGT CGCAGATATA CTCCGCCCAG AGTTTCCAGA CCGATGAGGC 
0061 CTTGCACCTG ATCGTGCTGC TTGTTAAGCA GTTTGGAGTG GTATCATGGC CCGAGGATCC 
0121 CACTGCCTTC CATGCTCTGA TCCAGAGGAT CGCTTTGGAC ATGGAAACCG ATGACACGGA 
0181 GAGAAAGTAC GAGCTCTGCC GTATCTTGGC TGATATCCTT ATTACCTGCC GTCGTGAGAT 
0241 TGTGATTAAT TCTCTGGAGG GTCAGATCTG GCCGGAGAGC TTGTTCAAGG GCTGTGGAGA 
0301 TATTCTGAAG GCCAAGATTG GCCCCAAGCA AAGGGATCCT GCACTGCATC TAATAGCCAC 
0361 CACCTTGCAT GTGCTGGGCA TCCAATGGGC CTTCATGGAC GAGCAGAAGA CTTTCTTCCT 
0421 GCAGCTCCTC CAACTGGGAG CTATCGAGGT GCGCATGCAA ATGGATGAGA AAAAACTGGA 
0481 AACCACCTTC AAGCAGGCGG  
 in silico PCR Fragment
0001 CGGAGCCATC CCCAAGATGT CGCAGATATA CTCCGCCCAG AGTTTCCAGA CCGATGAGGC 
0061 CTTGCACCTG ATCGTGCTGC TTGTTAAGCA GTTTGGAGTG GTATCATGGC CCGAGGATCC 
0121 CACTGCCTTC CATGCTCTGA TCCAGAGGAT CGCTTTGGAC ATGGAAACCG ATGACACGGA 
0181 GAGAAAGTAC GAGCTCTGCC GTATCTTGGC TGATATCCTT ATTACCTGCC GTCGTGAGAT 
0241 TGTGATTAAT TCTCTGGAGG GTCAGATCTG GCCGGAGAGC TTGTTCAAGG GCTGTGGAGA 
0301 TATTCTGAAG GCCAAGATTG GCCCCAAGCA AAGGGATCCT GCACTGCATC TAATAGCCAC 
0361 CACCTTGCAT GTGCTGGGCA TCCAATGGGC CTTCATGGAC GAGCAGAAGA CTTTCTTCCT 
0421 GCAGCTCCTC CAACTGGGAG CTATCGAGGT GCGCATGCAA ATGGATGAGA AAAAACTGGA 
0481 AACCACCTTC AAGCAGGCGG  
 Assemble Data

2330R-2.IR_full       1   CGGAGCCATCCCCAAGATGTCGCAGATATACTCCGCCCAGAGTTTCCAGACCGATGAGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     1   CGGAGCCATCCCCAAGATGTCGCAGATATACTCCGCCCAGAGTTTCCAGACCGATGAGGC 60


2330R-2.IR_full       61  CTTGCACCTGATCGTGCTGCTTGTTAAGCAGTTTGGAGTGGTATCATGGCCCGAGGATCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     61  CTTGCACCTGATCGTGCTGCTTGTTAAGCAGTTTGGAGTGGTATCATGGCCCGAGGATCC 120


2330R-2.IR_full       121 CACTGCCTTCCATGCTCTGATCCAGAGGATCGCTTTGGACATGGAAACCGATGACACGGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     121 CACTGCCTTCCATGCTCTGATCCAGAGGATCGCTTTGGACATGGAAACCGATGACACGGA 180


2330R-2.IR_full       181 GAGAAAGTACGAGCTCTGCCGTATCTTGGCTGATATCCTTATTACCTGCCGTCGTGAGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     181 GAGAAAGTACGAGCTCTGCCGTATCTTGGCTGATATCCTTATTACCTGCCGTCGTGAGAT 240


2330R-2.IR_full       241 TGTGATTAATTCTCTGGAGGGTCAGATCTGGCCGGAGAGCTTGTTCAAGGGCTGTGGAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     241 TGTGATTAATTCTCTGGAGGGTCAGATCTGGCCGGAGAGCTTGTTCAAGGGCTGTGGAGA 300


2330R-2.IR_full       301 TATTCTGAAGGCCAAGATTGGCCCCAAGCAAAGGGATCCTGCACTGCATCTAATAGCCAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     301 TATTCTGAAGGCCAAGATTGGCCCCAAGCAAAGGGATCCTGCACTGCATCTAATAGCCAC 360


2330R-2.IR_full       361 CACCTTGCATGTGCTGGGCATCCAATGGGCCTTCATGGACGAGCAGAAGACTTTCTTCCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     361 CACCTTGCATGTGCTGGGCATCCAATGGGCCTTCATGGACGAGCAGAAGACTTTCTTCCT 420


2330R-2.IR_full       421 GCAGCTCCTCCAACTGGGAGCTATCGAGGTGCGCATGCAAATGGATGAGAAAAAACTGGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2330R-2.in silico     421 GCAGCTCCTCCAACTGGGAGCTATCGAGGTGCGCATGCAAATGGATGAGAAAAAACTGGA 480


2330R-2.IR_full       481 AACCACCTTCAAGCAGGCGG 500
                          ||||||||||||||||||||
2330R-2.in silico     481 AACCACCTTCAAGCAGGCGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141401.1  CG2330-RA (CG2330), mRNA 
0   NM_001031935.1  CG32258-RB, transcript variant B (Gr64e), mRNA 
0   NM_168051.2  CG32258-RA, transcript variant A (Gr64e), mRNA 
0   NM_168050.2  CG14987-RA, transcript variant A (Gr64d), mRNA 
0   NM_143139.1  CG4553-RA (CG4553), mRNA 
0   NM_206280.1  CG18769-RF, transcript variant F (CG18769), mRNA 
0   NM_144449.2  CG18769-RA, transcript variant A (CG18769), mRNA 
0   NM_168170.1  CG18769-RC, transcript variant C (CG18769), mRNA 
0   NM_206281.1  CG18769-RE, transcript variant E (CG18769), mRNA 
0   NM_206282.1  CG18769-RD, transcript variant D (CG18769), mRNA 
0   NM_168169.2  CG18769-RB, transcript variant B (CG18769), mRNA 
0   NM_206640.1  CG12157-RB, transcript variant B (Tom40), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 
0   NM_079186.2  CG14981-RA, transcript variant A (mge), mRNA 
0   NM_168044.1  CG14981-RB, transcript variant B (mge), mRNA 
0   NM_078727.2  CG4426-RA (ast), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_135494.1  CG13127-RA (CG13127), mRNA 
0   NM_141089.1  CG11249-RA (CG11249), mRNA 
0   NM_132784.1  CG15031-RA (CG15031), mRNA 
0   11  NM_169626.1  CG4264-RC, transcript variant C (Hsc70-4), mRNA 
0   11  NM_169627.1  CG4264-RD, transcript variant D (Hsc70-4), mRNA 
0   11  NM_169625.1  CG4264-RB, transcript variant B (Hsc70-4), mRNA 
0   11  NM_176503.1  CG4264-RF, transcript variant F (Hsc70-4), mRNA 
0   11  NM_176502.1  CG4264-RE, transcript variant E (Hsc70-4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.