National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2330R-1 
 Symbol Neurochondrin  Full Name Neurochondrin 
 CG No CG2330  Old CG No CG2330 
 Synonyms Neurochondrin, CG2330 
 Accession No (Link to NCBI) NM_141401.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGAGCCATCCCCAAGATGTCGCAGATATACTCCGCCCAGAGTTTCCAGACCGATGAGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTTGCACCTGATCGTGCTGCTTGTTAAGCAGTTTGGAGTGGTATCATGGCCCGAGGATCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CACTGCCTTCCATGCTCTGATCCAGAGGATCGCTTTGGACATGGAAACCGATGACACGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGAAAGTACGAGCTCTGCCGTATCTTGGCTGATATCCTTATTACCTGCCGTCGTGAGAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGTGATTAATTCTCTGGAGGGTCAGATCTGGCCGGAGAGCTTGTTCAAGGGCTGTGGAGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATTCTGAAGGCCAAGATTGGCCCCAAGCAAAGGGATCCTGCACTGCATCTAATAGCCAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CACCTTGCATGTGCTGGGCATCCAATGGGCCTTCATGGACGAGCAGAAGACTTTCTTCCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCAGCTCCTCCAACTGGGAGCTATCGAGGTGCGCATGCAAATGGATGAGAAAAAACTGGA 480

2330R-1.IR_full       481 AACCACCTTCAAGCAGGCGG 500
                          |||||||||||||||||||| silico     481 AACCACCTTCAAGCAGGCGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141401.1  CG2330-RA (CG2330), mRNA 
0   NM_001031935.1  CG32258-RB, transcript variant B (Gr64e), mRNA 
0   NM_168051.2  CG32258-RA, transcript variant A (Gr64e), mRNA 
0   NM_168050.2  CG14987-RA, transcript variant A (Gr64d), mRNA 
0   NM_143139.1  CG4553-RA (CG4553), mRNA 
0   NM_206280.1  CG18769-RF, transcript variant F (CG18769), mRNA 
0   NM_144449.2  CG18769-RA, transcript variant A (CG18769), mRNA 
0   NM_168170.1  CG18769-RC, transcript variant C (CG18769), mRNA 
0   NM_206281.1  CG18769-RE, transcript variant E (CG18769), mRNA 
0   NM_206282.1  CG18769-RD, transcript variant D (CG18769), mRNA 
0   NM_168169.2  CG18769-RB, transcript variant B (CG18769), mRNA 
0   NM_206640.1  CG12157-RB, transcript variant B (Tom40), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 
0   NM_079186.2  CG14981-RA, transcript variant A (mge), mRNA 
0   NM_168044.1  CG14981-RB, transcript variant B (mge), mRNA 
0   NM_078727.2  CG4426-RA (ast), mRNA 
0   NM_057357.2  CG1569-RA (rod), mRNA 
0   NM_165479.1  CG15845-RA, transcript variant A (Adf1), mRNA 
0   NM_206028.1  CG15845-RC, transcript variant C (Adf1), mRNA 
0   NM_165480.1  CG15845-RB, transcript variant B (Adf1), mRNA 
0   NM_001043133.1  CG32045-RD, transcript variant D (fry), mRNA 
0   NM_168357.2  CG32045-RB, transcript variant B (fry), mRNA 
0   NM_135494.1  CG13127-RA (CG13127), mRNA 
0   NM_141089.1  CG11249-RA (CG11249), mRNA 
0   NM_132784.1  CG15031-RA (CG15031), mRNA 
0   11  NM_169626.1  CG4264-RC, transcript variant C (Hsc70-4), mRNA 
0   11  NM_169627.1  CG4264-RD, transcript variant D (Hsc70-4), mRNA 
0   11  NM_169625.1  CG4264-RB, transcript variant B (Hsc70-4), mRNA 
0   11  NM_176503.1  CG4264-RF, transcript variant F (Hsc70-4), mRNA 
0   11  NM_176502.1  CG4264-RE, transcript variant E (Hsc70-4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.