National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2225R-1 
 Symbol CG2225  Full Name CG2225 
 CG No CG2225  Old CG No CG2225 
 Synonyms CG2225 
 Accession No (Link to NCBI) NM_165392.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCGAGACTGAGCGGACGTTT 
 Primer Seq. 3'
aatctagaggtaccGCCTTTGGCAGCGTTGTCTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTCGAGACTG AGCGGACGTT TCAGCTGGAG GCAGGGCAAT CCTATGACAC AATGGCAGAA 
0061 TCTCATCGCG CATTCCATTC CCTGGAATTG GAGGCGGGAG CGGAGGTAGC CGTAGATGCC 
0121 GCTGTTGAAG CTGACTCAAA AAGACAAAAC GATAATCAAC TGCAGTCGTT GGAACCCATT 
0181 TCCTTGGATG ACATACCCGA ACCAATAAAA GTCCTCGACG AGATTATTTC CGAATTTGAG 
0241 GAGGCAGCAA CGAAACCAGT GGCCTTGAAC TGCAATAGTG GCGAGAATCA GTCCGAGGAC 
0301 GATGGCTACA TGAGCCTAAG TCGCAAGAAC ATGTCCAAAA AGGATTCCGA AGATGTGCCC 
0361 CAAACACCCA GCACAGACAC TGTGCCAGAG GGAAGCTTCA ACGAAGTGGA TGGTACGGCT 
0421 GAGAATCTAA CTAAATTATC TGAGGTTGTA CACGGACAGG AAACTACATC GCCTCTCATT 
0481 CAGACAACGC TGCCAAADGN  
 in silico PCR Fragment
0001 GTCGAGACTG AGCGGACGTT TCAGCTGGAG GCAGGGCAAT CCTATGACAC AATGGCAGAA 
0061 TCTCATCGCG CATTCCATTC CCTGGAATTG GAGGCGGGAG CGGAGGTAGC CGTAGATGCC 
0121 GCTGTTGAAG CTGACTCAAA AAGACAAAAC GATAATCAAC TGCAGTCGTT GGAACCCATT 
0181 TCCTTGGATG ACATACCCGA ACCAATAAAA GTCCTCGACG AGATTATTTC CGAATTTGAG 
0241 GAGGCAGCAA CGAAACCAGT GGCCTTGAAC TGCAATAGTG GCGAGAATCA GTCCGAGGAC 
0301 GATGGCTACA TGAGCCTAAG TCGCAAGAAC ATGTCCAAAA AGGATTCCGA AGATGTGCCC 
0361 CAAACACCCA GCACAGACAC TGTGCCAGAG GGAAGCTTCA ACGAAGTGGA TGGTACGGCT 
0421 GAGAATCTAA CTAAATTATC TGAGGTTGTA CACGGACAGG AAACTACATC GCCTCTCATT 
0481 CAGACAACGC TGCCAAAGGC  
 Assemble Data

2225R-1.IR_full       1   GTCGAGACTGAGCGGACGTTTCAGCTGGAGGCAGGGCAATCCTATGACACAATGGCAGAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     1   GTCGAGACTGAGCGGACGTTTCAGCTGGAGGCAGGGCAATCCTATGACACAATGGCAGAA 60


2225R-1.IR_full       61  TCTCATCGCGCATTCCATTCCCTGGAATTGGAGGCGGGAGCGGAGGTAGCCGTAGATGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     61  TCTCATCGCGCATTCCATTCCCTGGAATTGGAGGCGGGAGCGGAGGTAGCCGTAGATGCC 120


2225R-1.IR_full       121 GCTGTTGAAGCTGACTCAAAAAGACAAAACGATAATCAACTGCAGTCGTTGGAACCCATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     121 GCTGTTGAAGCTGACTCAAAAAGACAAAACGATAATCAACTGCAGTCGTTGGAACCCATT 180


2225R-1.IR_full       181 TCCTTGGATGACATACCCGAACCAATAAAAGTCCTCGACGAGATTATTTCCGAATTTGAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     181 TCCTTGGATGACATACCCGAACCAATAAAAGTCCTCGACGAGATTATTTCCGAATTTGAG 240


2225R-1.IR_full       241 GAGGCAGCAACGAAACCAGTGGCCTTGAACTGCAATAGTGGCGAGAATCAGTCCGAGGAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     241 GAGGCAGCAACGAAACCAGTGGCCTTGAACTGCAATAGTGGCGAGAATCAGTCCGAGGAC 300


2225R-1.IR_full       301 GATGGCTACATGAGCCTAAGTCGCAAGAACATGTCCAAAAAGGATTCCGAAGATGTGCCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     301 GATGGCTACATGAGCCTAAGTCGCAAGAACATGTCCAAAAAGGATTCCGAAGATGTGCCC 360


2225R-1.IR_full       361 CAAACACCCAGCACAGACACTGTGCCAGAGGGAAGCTTCAACGAAGTGGATGGTACGGCT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     361 CAAACACCCAGCACAGACACTGTGCCAGAGGGAAGCTTCAACGAAGTGGATGGTACGGCT 420


2225R-1.IR_full       421 GAGAATCTAACTAAATTATCTGAGGTTGTACACGGACAGGAAACTACATCGCCTCTCATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2225R-1.in silico     421 GAGAATCTAACTAAATTATCTGAGGTTGTACACGGACAGGAAACTACATCGCCTCTCATT 480


2225R-1.IR_full       481 CAGACAACGCTGCCAAADGN 500
                          ||||||||||||||||| | 
2225R-1.in silico     481 CAGACAACGCTGCCAAAGGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206020.2  CG2225-RE, transcript variant E (CG2225), mRNA 
100   482  NM_165392.2  CG2225-RA, transcript variant A (CG2225), mRNA 
100   482  NM_165393.2  CG2225-RB, transcript variant B (CG2225), mRNA 
31.74   153  NM_001014497.1  CG2225-RF, transcript variant F (CG2225), mRNA 
0.2   NM_080329.2  CG3697-RA (mei-9), mRNA 
0   NM_142496.2  CG7720-RB, transcript variant B (CG7720), mRNA 
0   NM_169834.1  CG7720-RA, transcript variant A (CG7720), mRNA 
0   NM_141996.2  CG12360-RA, transcript variant A (CG12360), mRNA 
0   NM_142461.2  CG14309-RA (CG14309), mRNA 
0   NM_140125.1  CG6640-RA, transcript variant A (CG6640), mRNA 
0   10  NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_169854.1  CG31212-RA (CG31212), mRNA 
0   NM_079580.2  CG6515-RA (Takr86C), mRNA 
0   NM_206109.1  CG8118-RC, transcript variant C (mam), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_206332.1  CG18331-RA (CG18331), mRNA 
0   NM_079804.2  CG5923-RA, transcript variant A (DNApol-alpha73), mRNA 
0   NM_170327.1  CG5923-RB, transcript variant B (DNApol-alpha73), mRNA 
0   NM_135767.1  CG5682-RA (CG5682), mRNA 
0   NM_168276.1  CG7037-RA, transcript variant A (Cbl), mRNA 
0   NM_169073.1  CG1088-RA, transcript variant A (Vha26), mRNA 
0   NM_079513.2  CG1088-RB, transcript variant B (Vha26), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_080331.2  CG3578-RA (bi), mRNA 
0   NM_135548.1  CG13140-RA (dpr19), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.