National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2168R-3 
 Symbol RpS3A  Full Name Ribosomal protein S3A 
 CG No CG2168  Old CG No CG2168 
 Synonyms CG2168, RPS3A, M(4)101, RpS3a, RPS3a, clone 2.29, M57g, C3, M[57g], M(4)57g, M(4)[57g], l(4)102ABa, anon-EST:Liang-2.29, RpS3A 
 Accession No (Link to NCBI) NM_079879.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGTCTTTCCAAGGGTGGTAA 
 Primer Seq. 3'
aatctagaggtaccGTACCCATCTACAGTCTTTGC 
 Predicted Fragment Size
388 
 IR fragment full Seq
0001 AGGTCTTTCC AAGGGTGGTA AGAAGGGCGG TAAGAAGAAG GTGGTGGACC CGTTTTCTCG 
0061 CAAGGACTGG TACGATGTCA AAGCTCCGAA TATGTTTCAA ACCCGTCAAA TCGGTAAAAC 
0121 ACTTGTAAAC CGCACCCAGG GTCAAAGAAT AGCATCGGAT TATTTGAAGG GTCGCGTTTT 
0181 CGAAGTGTCT TTAGCAGACT TGCAAAAGGA TATTGATCCA GAACGTTCTT TTCGCAAGTT 
0241 CCGTCTTATT GCAGAAGATG TTCAAGACCG TAATGTGCTC TGTAACTTTC ACGGAATGGA 
0301 CTTGACTACG GACAAGTACA GGTCGATGGT TAAAAAGTGG CAAACACTAA TTGAAGCTAT 
0361 TGTCGAAGCA AAGACTGTAG ATGGGTAC 
 in silico PCR Fragment
0001 AGGTCTTTCC AAGGGTGGTA AGAAGGGCGG TAAGAAGAAG GTGGTGGACC CGTTTTCTCG 
0061 CAAGGACTGG TACGATGTCA AAGCTCCGAA TATGTTTCAA ACCCGTCAAA TCGGTAAAAC 
0121 ACTTGTAAAC CGCACCCAGG GTCAAAGAAT AGCATCGGAT TATTTGAAGG GTCGCGTTTT 
0181 CGAAGTGTCT TTAGCAGACT TGCAAAAGGA TATTGATCCA GAACGTTCTT TTCGCAAGTT 
0241 CCGTCTTATT GCAGAAGATG TTCAAGACCG TAATGTGCTC TGTAACTTTC ACGGAATGGA 
0301 CTTGACTACG GACAAGTACA GGTCGATGGT TAAAAAGTGG CAAACACTAA TTGAAGCTAT 
0361 TGTCGAAGCA AAGACTGTAG ATGGGTAC 
 Assemble Data

2168R-3.IR_full       1   AGGTCTTTCCAAGGGTGGTAAGAAGGGCGGTAAGAAGAAGGTGGTGGACCCGTTTTCTCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     1   AGGTCTTTCCAAGGGTGGTAAGAAGGGCGGTAAGAAGAAGGTGGTGGACCCGTTTTCTCG 60


2168R-3.IR_full       61  CAAGGACTGGTACGATGTCAAAGCTCCGAATATGTTTCAAACCCGTCAAATCGGTAAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     61  CAAGGACTGGTACGATGTCAAAGCTCCGAATATGTTTCAAACCCGTCAAATCGGTAAAAC 120


2168R-3.IR_full       121 ACTTGTAAACCGCACCCAGGGTCAAAGAATAGCATCGGATTATTTGAAGGGTCGCGTTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     121 ACTTGTAAACCGCACCCAGGGTCAAAGAATAGCATCGGATTATTTGAAGGGTCGCGTTTT 180


2168R-3.IR_full       181 CGAAGTGTCTTTAGCAGACTTGCAAAAGGATATTGATCCAGAACGTTCTTTTCGCAAGTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     181 CGAAGTGTCTTTAGCAGACTTGCAAAAGGATATTGATCCAGAACGTTCTTTTCGCAAGTT 240


2168R-3.IR_full       241 CCGTCTTATTGCAGAAGATGTTCAAGACCGTAATGTGCTCTGTAACTTTCACGGAATGGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     241 CCGTCTTATTGCAGAAGATGTTCAAGACCGTAATGTGCTCTGTAACTTTCACGGAATGGA 300


2168R-3.IR_full       301 CTTGACTACGGACAAGTACAGGTCGATGGTTAAAAAGTGGCAAACACTAATTGAAGCTAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2168R-3.in silico     301 CTTGACTACGGACAAGTACAGGTCGATGGTTAAAAAGTGGCAAACACTAATTGAAGCTAT 360


2168R-3.IR_full       361 TGTCGAAGCAAAGACTGTAGATGGGTAC 388
                          ||||||||||||||||||||||||||||
2168R-3.in silico     361 TGTCGAAGCAAAGACTGTAGATGGGTAC 388

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   300  NM_166715.2  CG2168-RD, transcript variant D (RpS3A), mRNA 
94.66   284  NM_079879.2  CG2168-RA, transcript variant A (RpS3A), mRNA 
84.66   254  NM_166714.2  CG2168-RB, transcript variant B (RpS3A), mRNA 
0   NM_132766.2  CG9053-RA, transcript variant A (CG9053), mRNA 
0   NM_167427.1  CG9053-RB, transcript variant B (CG9053), mRNA 
0   NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_141392.2  CG10286-RA (CG10286), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_057631.4  CG5786-RA (ppan), mRNA 
0   NM_137510.2  CG30122-RB (CG30122), mRNA 
0   NM_132508.2  CG1703-RA (CG1703), mRNA 
0   11  NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_141453.2  CG1234-RA (CG1234), mRNA 
0   NM_079251.2  CG6253-RA (RpL14), mRNA 
0   NM_140412.1  CG8833-RA (CG8833), mRNA 
0   NM_136158.2  CG10538-RA (CdGAPr), mRNA 
0   NM_175925.1  CG1651-RA, transcript variant A (Ank), mRNA 
0   NM_175926.1  CG1651-RB, transcript variant B (Ank), mRNA 
0   NM_175928.1  CG1651-RD, transcript variant D (Ank), mRNA 
0   NM_175927.1  CG1651-RC, transcript variant C (Ank), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_144243.1  CG13364-RA (CG13364), mRNA 
0   NM_139401.1  CG13933-RA (CG13933), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_001042868.1  CG34124-RA (CG34124), mRNA 
0   NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
 
Caspase-3 signal
N
DB
DC
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.