National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2163R-2 
 Symbol Pabp2  Full Name Pabp2 
 CG No CG2163  Old CG No CG2163 
 Synonyms pabp2, CG2163, pAbp2, rox2, dpabII, ROX2, Rox2, Pabp2, PABP2 
 Accession No (Link to NCBI) NM_057554.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shan L, Wu C, Chen D, Hou L, Li X, Wang L, Chu X, Hou Y, Wang Z.
Regulators of alternative polyadenylation operate at the transition from mitosis to meiosis.
J Genet Genomics (2017) 44(2) 95-106 [ PubMed ID = 28190776 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCGTCTACGTGGGCAATGTG 
 Primer Seq. 3'
aatctagaggtaccGGAGCGTAGTAATTGGCGCGA 
 Predicted Fragment Size
380 
 IR fragment full Seq
0001 TCCGTCTACG TGGGCAATGT GGACTACGGC GCATCGGCCG AGGAACTGGA GGCCCACTTC 
0061 CACGGATGCG GCACCATCAA CCGAGTAACC ATACTCTGCA ACAAGGCTGA CGGGCACCCC 
0121 AAGGGATTCG CATACATTGA GTTTGGTTCC AAGGAGTTTG TCGAGACGGC ATTGGCCATG 
0181 AACGAAACCC TCTTCCGAGG GCGTCAAATA AAGGTAATGT CGAAGCGCAC AAACCGCCCT 
0241 GGACTCTCCA CCACAAACCG TTTCGCACGC GGCAGCTTCC GGGGTCGAGG AGCCCGTGTC 
0301 TCCCGGGCGT NGCTGTCACT CCACCTTCCG AGGCGCCCGA AGAGCTATGG GTTACCGTGG 
0361 TCGCGCCAAT TACTACGCTC C 
 in silico PCR Fragment
0001 TCCGTCTACG TGGGCAATGT GGACTACGGC GCATCGGCCG AGGAACTGGA GGCCCACTTC 
0061 CACGGATGCG GCACAATCAA CCGAGTAACC ATACTCTGCA ACAAGGCTGA CGGGCACCCC 
0121 AAGGGATTCG CATACATTGA GTTTGGTTCC AAGGAGTTTG TCGAGACGGC ATTGGCCATG 
0181 AACGAAACCC TCTTCCGAGG GCGTCAAATA AAGGTAATGT CGAAGCGCAC AAACCGCCCT 
0241 GGACTCTCCA CCACAAACCG TTTCGCACGC GGCAGCTTCC GGGGTCGAGG AGCCCGTGTC 
0301 TCCCGGGCGT -GCTGTCACT CCACCTTCCG AGGCGCCCGA AGAGCTATGG GTTACCGTGG 
0361 TCGCGCCAAT TACTACGCTC C 
 Assemble Data

2163R-2.IR_full       1   TCCGTCTACGTGGGCAATGTGGACTACGGCGCATCGGCCGAGGAACTGGAGGCCCACTTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     1   TCCGTCTACGTGGGCAATGTGGACTACGGCGCATCGGCCGAGGAACTGGAGGCCCACTTC 60


2163R-2.IR_full       61  CACGGATGCGGCACCATCAACCGAGTAACCATACTCTGCAACAAGGCTGACGGGCACCCC 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     61  CACGGATGCGGCACAATCAACCGAGTAACCATACTCTGCAACAAGGCTGACGGGCACCCC 120


2163R-2.IR_full       121 AAGGGATTCGCATACATTGAGTTTGGTTCCAAGGAGTTTGTCGAGACGGCATTGGCCATG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     121 AAGGGATTCGCATACATTGAGTTTGGTTCCAAGGAGTTTGTCGAGACGGCATTGGCCATG 180


2163R-2.IR_full       181 AACGAAACCCTCTTCCGAGGGCGTCAAATAAAGGTAATGTCGAAGCGCACAAACCGCCCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     181 AACGAAACCCTCTTCCGAGGGCGTCAAATAAAGGTAATGTCGAAGCGCACAAACCGCCCT 240


2163R-2.IR_full       241 GGACTCTCCACCACAAACCGTTTCGCACGCGGCAGCTTCCGGGGTCGAGGAGCCCGTGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     241 GGACTCTCCACCACAAACCGTTTCGCACGCGGCAGCTTCCGGGGTCGAGGAGCCCGTGTC 300


2163R-2.IR_full       301 TCCCGGGCGTNGCTGTCACTCCACCTTCCGAGGCGCCCGAAGAGCTATGGGTTACCGTGG 360
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
2163R-2.in silico     301 TCCCGGGCGT-GCTGTCACTCCACCTTCCGAGGCGCCCGAAGAGCTATGGGTTACCGTGG 360


2163R-2.IR_full       361 TCGCGCCAATTACTACGCTCC 381
                          |||||||||||||||||||||
2163R-2.in silico     361 TCGCGCCAATTACTACGCTCC 381

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   362  NM_057554.2  CG2163-RA, transcript variant A (Pabp2), mRNA 
100   362  NM_165589.1  CG2163-RB, transcript variant B (Pabp2), mRNA 
0   NM_165972.1  CG30058-RA (CG30058), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_135301.2  CG7196-RA, transcript variant A (CG7196), mRNA 
0   NM_164770.1  CG7196-RB, transcript variant B (CG7196), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_140284.1  CG6793-RA (CG6793), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_078873.2  CG15162-RA (MESR3), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_132214.1  CG15335-RB (CG15335), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_167174.1  CG32708-RA (CG32708), mRNA 
0   NM_168297.1  CG32026-RA (CG32026), mRNA 
0   NM_141367.1  CG15590-RA (Osi5), mRNA 
0   NM_141546.2  CG11737-RA (CG11737), mRNA 
0   NM_138238.1  CG13913-RA (CG13913), mRNA 
0   NM_143243.2  CG14245-RA, transcript variant A (CG14245), mRNA 
0   NM_144003.2  CG14246-RA, transcript variant A (CG14246), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_058125.3  CG1341-RA (Rpt1), mRNA 
0   NM_206364.1  CG11552-RA (CG11552), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.