National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2163R-1 
 Symbol Pabp2  Full Name Pabp2 
 CG No CG2163  Old CG No CG2163 
 Synonyms pabp2, CG2163, pAbp2, rox2, dpabII, ROX2, Rox2, Pabp2, PABP2 
 Accession No (Link to NCBI) NM_057554.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Shan L, Wu C, Chen D, Hou L, Li X, Wang L, Chu X, Hou Y, Wang Z.
Regulators of alternative polyadenylation operate at the transition from mitosis to meiosis.
J Genet Genomics (2017) 44(2) 95-106 [ PubMed ID = 28190776 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCCGTCTACGTGGGCAATGTGGACTACGGCGCATCGGCCGAGGAACTGGAGGCCCACTTC 60

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACGGATGCGGCACAATCAACCGAGTAACCATACTCTGCAACAAGGCTGACGGGCACCCC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGGGATTCGCATACATTGAGTTTGGTTCCAAGGAGTTTGTCGAGACGGCATTGGCCATG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AACGAAACCCTCTTCCGAGGGCGTCAAATAAAGGTAATGTCGAAGCGCACAAACCGCCCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGACTCTCCACCACAAACCGTTTCGCACGCGGCAGCTTCCGGGGTCGAGGAGCCCGTGTC 300

                          |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCCGGGCGT-GCTGTCACTCCACCTTCCGAGGCGCCCGAAGAGCTATGGGTTACCGTGG 360

2163R-1.IR_full       361 TCGCGCCAATTACTACGCTCC 381
                          ||||||||||||||||||||| silico     361 TCGCGCCAATTACTACGCTCC 381

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   362  NM_057554.2  CG2163-RA, transcript variant A (Pabp2), mRNA 
100   362  NM_165589.1  CG2163-RB, transcript variant B (Pabp2), mRNA 
0   NM_165972.1  CG30058-RA (CG30058), mRNA 
0   NM_134601.1  CG1718-RA (CG1718), mRNA 
0   NM_135301.2  CG7196-RA, transcript variant A (CG7196), mRNA 
0   NM_164770.1  CG7196-RB, transcript variant B (CG7196), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_140284.1  CG6793-RA (CG6793), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_079235.2  CG8571-RA, transcript variant A (smid), mRNA 
0   NM_206287.1  CG8571-RB, transcript variant B (smid), mRNA 
0   NM_078873.2  CG15162-RA (MESR3), mRNA 
0   NM_141731.1  CG3996-RA (CG3996), mRNA 
0   NM_132214.1  CG15335-RB (CG15335), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_167174.1  CG32708-RA (CG32708), mRNA 
0   NM_168297.1  CG32026-RA (CG32026), mRNA 
0   NM_141367.1  CG15590-RA (Osi5), mRNA 
0   NM_141546.2  CG11737-RA (CG11737), mRNA 
0   NM_138238.1  CG13913-RA (CG13913), mRNA 
0   NM_143243.2  CG14245-RA, transcript variant A (CG14245), mRNA 
0   NM_144003.2  CG14246-RA, transcript variant A (CG14246), mRNA 
0   NM_137794.2  CG11073-RA (CG11073), mRNA 
0   NM_058125.3  CG1341-RA (Rpt1), mRNA 
0   NM_206364.1  CG11552-RA (CG11552), mRNA 
0   NM_132097.1  CG3950-RA (CG3950), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.