National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2160R-4 
 Symbol Socs44A  Full Name Suppressor of Cytokine Signaling at 44A 
 CG No CG2160  Old CG No CG2160 
 Synonyms dmSocs44A, SOCS, SOCS44A, socs44A, CG2160, Socs44E, Socs44A 
 Accession No (Link to NCBI) NM_078935.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees abnormal genitalia 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACGGCGACCAGAGTCAAAAC 
 Primer Seq. 3'
aatctagaggtaccTCCTCGCGCTCAAGCCATTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACGGCGAGC CAGAGTCAAA ACCAGAGCAG CCAGCGGANC CAGGCGCTCA CTGGCGGTGG 
0061 TGACTCCGCG AGGGACAGGG AGAAGGAAAA GAAGGGCTGG TTCCACTCGC TGACCAGGCG 
0121 CAAGAAGTCC GACTCGGCGC TGGCCGTGAC TGCATCCGCC GCCGTCTCCA CCAGTGGATC 
0181 GCAGAACAAC AACAACGAAG TGTNGCGTCC TTGAGGCAGC GGACACTTCC ATGGCCAGCT 
0241 GCAGCAATGG GGGCACGGGC ACAGGAACTC TGCGCAGAAG GCGGGACAAG GACAAGCGAA 
0301 ACGTGTTTGC CAGACTACGA AGGAAGGTGG GCCAAGGGCT CAGCTCCCTG CGAAACTGGC 
0361 ACTCCATGGG CGACTGCGAC GACGGCGGAA CTACTGATGC CACCTACGAG TTCCTTACGC 
0421 CGGCCATCTG TCCGGAACCC ACGCTACCAT TTACACACGA CTACTTGCGC TTTACCCGGA 
0481 AGAAATGGCT TGAGCGCGAG GA 
 in silico PCR Fragment
0001 CACGGCGA-C CAGAGTCAAA ACCAGAGCAG CCAGCGGAGC CAGGCGCTCA CTGGCGGTGG 
0061 TGACTCCCCG AGGGACAGGG AGAAGGAAAA GAAGGGCTGG TTCCACTCGC TGACCAGGCG 
0121 CAAGAAGTCC GACTCGGCGC TGGCCGTGAC TGCATCCGCC GCCGTCTCCA CCAGTGGATC 
0181 GCAGAACAAC AACAACGAAG TGT-GCGTCC TTGAGGCAGC GGACTCTTCC ATGGCCAGCT 
0241 GCAGCAATGG GGGCACGGGC ACAGGAACTC TGCGCAGAAG GCGGGACAAG GACAAGCGAA 
0301 ACGTGTTTGC CAGACTACGA AGGAAGGTGG GCCAAGGGCT CAGCTCCCTG CGAAACTGGC 
0361 ACTCCATGGG CGACTGCGAC GACGGCGGAA CTACTGATGC CACCTACGAG TTCCTTACGC 
0421 CGGCCATCTG TCCGGAACCC ACGCTACCAT TCACACACGA CTACTTGCGC TTTATCCGGA 
0481 AGAAATGGCT TGAGCGCGAG GA 
 Assemble Data

2160R-4.IR_full       1   CACGGCGAGCCAGAGTCAAAACCAGAGCAGCCAGCGGANCCAGGCGCTCACTGGCGGTGG 60
                          |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||
2160R-4.in silico     1   CACGGCGA-CCAGAGTCAAAACCAGAGCAGCCAGCGGAGCCAGGCGCTCACTGGCGGTGG 60


2160R-4.IR_full       61  TGACTCCGCGAGGGACAGGGAGAAGGAAAAGAAGGGCTGGTTCCACTCGCTGACCAGGCG 120
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
2160R-4.in silico     61  TGACTCCCCGAGGGACAGGGAGAAGGAAAAGAAGGGCTGGTTCCACTCGCTGACCAGGCG 120


2160R-4.IR_full       121 CAAGAAGTCCGACTCGGCGCTGGCCGTGACTGCATCCGCCGCCGTCTCCACCAGTGGATC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2160R-4.in silico     121 CAAGAAGTCCGACTCGGCGCTGGCCGTGACTGCATCCGCCGCCGTCTCCACCAGTGGATC 180


2160R-4.IR_full       181 GCAGAACAACAACAACGAAGTGTNGCGTCCTTGAGGCAGCGGACACTTCCATGGCCAGCT 240
                          ||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||
2160R-4.in silico     181 GCAGAACAACAACAACGAAGTGT-GCGTCCTTGAGGCAGCGGACTCTTCCATGGCCAGCT 240


2160R-4.IR_full       241 GCAGCAATGGGGGCACGGGCACAGGAACTCTGCGCAGAAGGCGGGACAAGGACAAGCGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2160R-4.in silico     241 GCAGCAATGGGGGCACGGGCACAGGAACTCTGCGCAGAAGGCGGGACAAGGACAAGCGAA 300


2160R-4.IR_full       301 ACGTGTTTGCCAGACTACGAAGGAAGGTGGGCCAAGGGCTCAGCTCCCTGCGAAACTGGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2160R-4.in silico     301 ACGTGTTTGCCAGACTACGAAGGAAGGTGGGCCAAGGGCTCAGCTCCCTGCGAAACTGGC 360


2160R-4.IR_full       361 ACTCCATGGGCGACTGCGACGACGGCGGAACTACTGATGCCACCTACGAGTTCCTTACGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2160R-4.in silico     361 ACTCCATGGGCGACTGCGACGACGGCGGAACTACTGATGCCACCTACGAGTTCCTTACGC 420


2160R-4.IR_full       421 CGGCCATCTGTCCGGAACCCACGCTACCATTTACACACGACTACTTGCGCTTTACCCGGA 480
                          ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||
2160R-4.in silico     421 CGGCCATCTGTCCGGAACCCACGCTACCATTCACACACGACTACTTGCGCTTTATCCGGA 480


2160R-4.IR_full       481 AGAAATGGCTTGAGCGCGAGGA 502
                          ||||||||||||||||||||||
2160R-4.in silico     481 AGAAATGGCTTGAGCGCGAGGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078935.2  CG2160-RA (Socs44A), mRNA 
0   12  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   12  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   11  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   13  NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_141381.2  CG15598-RA (Osi17), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_137937.2  CG3502-RA (CG3502), mRNA 
0   NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0   NM_132425.3  CG15211-RA (CG15211), mRNA 
0   NM_134494.2  CG12235-RA (Arp11), mRNA 
0   NM_164319.2  CG1106-RA, transcript variant A (Gel), mRNA 
0   NM_206427.1  CG1106-RG, transcript variant G (Gel), mRNA 
0   NM_001043192.1  CG1106-RI, transcript variant I (Gel), mRNA 
0   NM_176394.1  CG1106-RF, transcript variant F (Gel), mRNA 
0   NM_080126.2  CG1106-RB, transcript variant B (Gel), mRNA 
0   NM_206426.1  CG1106-RH, transcript variant H (Gel), mRNA 
0   NM_164321.2  CG1106-RD, transcript variant D (Gel), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_166094.1  CG8174-RC, transcript variant C (SRPK), mRNA 
0   NM_137190.2  CG8174-RB, transcript variant B (SRPK), mRNA 
0   NM_166093.1  CG8174-RA, transcript variant A (SRPK), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.