National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2160R-3 
 Symbol Socs44A  Full Name Suppressor of Cytokine Signaling at 44A 
 CG No CG2160  Old CG No CG2160 
 Synonyms dmSocs44A, SOCS, SOCS44A, socs44A, CG2160, Socs44E, Socs44A 
 Accession No (Link to NCBI) NM_078935.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal, female semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     1   CACGGCGA-CCAGAGTCAAAACCAGAGCAGCCAGCGGAGCCAGGCGCTCACTGGCGGTGG 60

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGACTCCCCGAGGGACAGGGAGAAGGAAAAGAAGGGCTGGTTCCACTCGCTGACCAGGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAAGAAGTCCGACTCGGCGCTGGCCGTGACTGCATCCGCCGCCGTCTCCACCAGTGGATC 180

                          ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| silico     181 GCAGAACAACAACAACGAAGTGT-GCGTCCTTGAGGCAGCGGACTCTTCCATGGCCAGCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCAGCAATGGGGGCACGGGCACAGGAACTCTGCGCAGAAGGCGGGACAAGGACAAGCGAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACGTGTTTGCCAGACTACGAAGGAAGGTGGGCCAAGGGCTCAGCTCCCTGCGAAACTGGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACTCCATGGGCGACTGCGACGACGGCGGAACTACTGATGCCACCTACGAGTTCCTTACGC 420

                          ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| silico     421 CGGCCATCTGTCCGGAACCCACGCTACCATTCACACACGACTACTTGCGCTTTATCCGGA 480

2160R-3.IR_full       481 AGAAATGGCTTGAGCGCGAGGA 502
                          |||||||||||||||||||||| silico     481 AGAAATGGCTTGAGCGCGAGGA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078935.2  CG2160-RA (Socs44A), mRNA 
0   12  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   12  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   11  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   13  NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_001038984.1  CG12877-RC, transcript variant C (CG12877), mRNA 
0   NM_143327.2  CG12877-RA, transcript variant A (CG12877), mRNA 
0   NM_170355.2  CG12877-RB, transcript variant B (CG12877), mRNA 
0   NM_141381.2  CG15598-RA (Osi17), mRNA 
0   NM_169177.1  CG2507-RB, transcript variant B (sas), mRNA 
0   NM_057263.2  CG2507-RA, transcript variant A (sas), mRNA 
0   NM_137937.2  CG3502-RA (CG3502), mRNA 
0   NM_080337.2  CG6899-RA, transcript variant A (Ptp4E), mRNA 
0   NM_132425.3  CG15211-RA (CG15211), mRNA 
0   NM_134494.2  CG12235-RA (Arp11), mRNA 
0   NM_164319.2  CG1106-RA, transcript variant A (Gel), mRNA 
0   NM_206427.1  CG1106-RG, transcript variant G (Gel), mRNA 
0   NM_001043192.1  CG1106-RI, transcript variant I (Gel), mRNA 
0   NM_176394.1  CG1106-RF, transcript variant F (Gel), mRNA 
0   NM_080126.2  CG1106-RB, transcript variant B (Gel), mRNA 
0   NM_206426.1  CG1106-RH, transcript variant H (Gel), mRNA 
0   NM_164321.2  CG1106-RD, transcript variant D (Gel), mRNA 
0   NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
0   NM_206161.1  CG5580-RB, transcript variant B (sbb), mRNA 
0   NM_206162.1  CG5580-RC, transcript variant C (sbb), mRNA 
0   NM_166094.1  CG8174-RC, transcript variant C (SRPK), mRNA 
0   NM_137190.2  CG8174-RB, transcript variant B (SRPK), mRNA 
0   NM_166093.1  CG8174-RA, transcript variant A (SRPK), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.