National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2128R-2 
 Symbol Hdac3  Full Name Hdac3 
 CG No CG2128  Old CG No CG2128 
 Synonyms HDAC3, dmHDA402, HDAC, dHDAC3, DmHDAC3, CG2128, Hdac3, DHDAC3 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCATCCCATGAAGCCGCAAC 
 Primer Seq. 3'
aatctagaggtaccAAGGTAGAACGCCTCCTGCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGCATCCCAT GAAGCCGCAA CGCTGGCGGT CACTCACAGC CTGGTAATGA ACTACGGACT 
0061 GCACAAGAAA ATGAAGATCT ACAGGCCGTA CAAGGCCAGT GCGCAGGACA TGCTCCGCTT 
0121 CCACAGCGAC GAGTACATCG CCTACTTACA GCAGGTGACT CCACAAAACA TTCAGTGCAA 
0181 TTCCGTGGCC TATACGAAGT ACCTGGCGCA CTTCAGCGTA GGCGAGGACT GTCCNGTGTT 
0241 CGATGGCCTC TTCGACTTCT GTGCAATGTA CACGGGTGCC TCGCTGGAGG GAGCCCAGAA 
0301 GCTGAACCAC AACCACAGCG ACATATGCAT AAACTGGTCG GGCGGACTGC ATCACGCCAA 
0361 GAAGTTCGAG GCAAGCGGAT TCTGCTACGT GAATGACATC GTCATCGGCA TTCTGGAGCT 
0421 GCTTAAGTAC CATCCTCGGG TGCTCTACAT CGACATCGAT GTGCACCACG GCGACGGGTG 
0481 CAGGAGGCGT TCTACCTT 
 in silico PCR Fragment
0001 GGCATCCCAT GAAGCCGCAA CGCCTGGCGG TCACTCACAG CCTGGTAATG AACTACGGAC 
0061 TGCACAAGAA AATGAAGATC TACAGGCCGT ACAAGGCCAG TGCGCAGGAC ATGCTCCGCT 
0121 TCCACAGCGA CGAGTACATC GCCTACTTAC AGCAGGTGAC TCCACAAAAC ATTCAGTGCA 
0181 ATTCCGTGGC CTATACGAAG TACCTGGCGC ACTTCAGCGT AGGCGAGGAC TGTCCCGTGT 
0241 TCGATGGCCT CTTCGACTTC TGTGCAATGT ACACGGGTGC CTCGCTGGAG GGAGCCCAGA 
0301 AGCTGAACCA CAACCACAGC GACATATGCA TAAACTGGTC GGGCGGACTG CATCACGCCA 
0361 AGAAGTTCGA GGCAAGCGGA TTCTGCTACG TGAATGACAT CGTCATCGGC ATTCTGGAGC 
0421 TGCTTAAGTA CCATCCTCGG GTGCTCTACA TCGACATCGA TGTGCACCAC GGCGACGGGG 
0481 TGCAGGAGGC GTTCTACCTT  
 Assemble Data

2128R-2.IR full       1   GGCATCCCATGAAGCCGCAACGC-TGGCGGTCACTCACAGCCTGGTAATGAACTACGGAC 60
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
2128R-2.in silico     1   GGCATCCCATGAAGCCGCAACGCCTGGCGGTCACTCACAGCCTGGTAATGAACTACGGAC 60


2128R-2.IR full       61  TGCACAAGAAAATGAAGATCTACAGGCCGTACAAGGCCAGTGCGCAGGACATGCTCCGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2128R-2.in silico     61  TGCACAAGAAAATGAAGATCTACAGGCCGTACAAGGCCAGTGCGCAGGACATGCTCCGCT 120


2128R-2.IR full       121 TCCACAGCGACGAGTACATCGCCTACTTACAGCAGGTGACTCCACAAAACATTCAGTGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2128R-2.in silico     121 TCCACAGCGACGAGTACATCGCCTACTTACAGCAGGTGACTCCACAAAACATTCAGTGCA 180


2128R-2.IR full       181 ATTCCGTGGCCTATACGAAGTACCTGGCGCACTTCAGCGTAGGCGAGGACTGTCCNGTGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
2128R-2.in silico     181 ATTCCGTGGCCTATACGAAGTACCTGGCGCACTTCAGCGTAGGCGAGGACTGTCCCGTGT 240


2128R-2.IR full       241 TCGATGGCCTCTTCGACTTCTGTGCAATGTACACGGGTGCCTCGCTGGAGGGAGCCCAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2128R-2.in silico     241 TCGATGGCCTCTTCGACTTCTGTGCAATGTACACGGGTGCCTCGCTGGAGGGAGCCCAGA 300


2128R-2.IR full       301 AGCTGAACCACAACCACAGCGACATATGCATAAACTGGTCGGGCGGACTGCATCACGCCA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2128R-2.in silico     301 AGCTGAACCACAACCACAGCGACATATGCATAAACTGGTCGGGCGGACTGCATCACGCCA 360


2128R-2.IR full       361 AGAAGTTCGAGGCAAGCGGATTCTGCTACGTGAATGACATCGTCATCGGCATTCTGGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2128R-2.in silico     361 AGAAGTTCGAGGCAAGCGGATTCTGCTACGTGAATGACATCGTCATCGGCATTCTGGAGC 420


2128R-2.IR full       421 TGCTTAAGTACCATCCTCGGGTGCTCTACATCGACATCGATGTGCACCACGGCGACGGG- 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
2128R-2.in silico     421 TGCTTAAGTACCATCCTCGGGTGCTCTACATCGACATCGATGTGCACCACGGCGACGGGG 480


2128R-2.IR full       481 TGCAGGAGGCGTTCTACCTT 500
                          ||||||||||||||||||||
2128R-2.in silico     481 TGCAGGAGGCGTTCTACCTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.