National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2125R-1 
 Symbol ci  Full Name cubitus interruptus 
 CG No CG2125  Old CG No CG2125 
 Synonyms Gli, Ci, CI, CG2125, ci155, CID, CiD, ciD, l(4)17, ci[D], ci-D, Ci[D], Ce, l(4)13, l(4)102ABc, ci, Ci/GLI 
 Accession No (Link to NCBI) NM_079878.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Velarde SB, Quevedo A, Estella C, Baonza A.
Dpp and Hedgehog promote the glial response to neuronal apoptosis in the developing Drosophila visual system.
PLoS Biol (2021) 19(8) e3001367 [ PubMed ID = 34379617 ] [ RRC reference ]

Lai CM, Lin KY, Kao SH, Chen YN, Huang F, Hsu HJ.
Hedgehog signaling establishes precursors for germline stem cell niches by regulating cell adhesion.
J Cell Biol (2017) 216(5) 1439-1453 [ PubMed ID = 28363970 ] [ RRC reference ]

Zhang Z, Lv X, Jiang J, Zhang L, Zhao Y.
Dual roles of Hh signaling in the regulation of somatic stem cell self-renewal and germline stem cell maintenance in Drosophila testis.
Cell Res (2013) 23(4) 573-6 [ PubMed ID = 23419515 ] [ RRC reference ]

Zhang Z, Feng J, Pan C, Lv X, Wu W, Zhou Z, Liu F, Zhang L, Zhao Y.
Atrophin-Rpd3 complex represses Hedgehog signaling by acting as a corepressor of CiR.
J Cell Biol (2013) 203(4) 575-83 [ PubMed ID = 24385484 ] [ RRC reference ]

Han H, Pan C, Liu C, Lv X, Yang X, Xiong Y, Lu Y, Wu W, Han J, Zhou Z, Jiang H, Zhang L, Zhao Y.
Gut-neuron interaction via Hh signaling regulates intestinal progenitor cell differentiation in Drosophila.
Cell Discov (2015) 1 15006 [ PubMed ID = 27462407 ] [ RRC reference ]

Terriente-Félix A, Molnar C, Gómez-Skarmeta JL, de Celis JF.
A conserved function of the chromatin ATPase Kismet in the regulation of hedgehog expression.
Dev Biol (2011) 350(2) 382-92 [ PubMed ID = 21146514 ] [ RRC reference ]

Sato T, Ogata J, Niki Y.
BMP and Hh signaling affects primordial germ cell division in Drosophila.
Zoolog Sci (2010) 27(10) 804-10 [ PubMed ID = 20887178 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAAATG-GACGCCTACGCGTTACCTACATATTTTCCTCTTGCGTATTCTGAATTGCAGTT 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTTAGCGTCCAGGAGAGCAGCTGCCGTCGCTGCAGCGGCTACTGTTTTACCAGGATCACC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATGCATAAACCAACATCACCCAACTGACGTTTCAAGCTCGGTAACAGTGCCATCAATTAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCAACGGGTGGAACATCAGATTCAATTAAAACTTCAATACAACCACAAATATGCAATGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAACACCCTTCTTGGAAATGCTGGCCACCAGCACAATCATCAGCCTCAACATGTTCACAA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATAAATGTTACTGGACAGCCACATGACTTTCACCCGGCCTATAGAATTCCCGGATACAT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGAACAGTTGTATTCTCTTCAACGAACTAATTCAGCTTCATCTTTTCACGATCCCTATGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAATTGTGCATCAGCATTCCATCTTGCCGGACTTGGTTTGGGATCAGCTGATTTTTTGGG 480

                          |||||||||||||||||||||||||||||||||||||||||||| silico     481 CAGCCGAGGTTTGAGCTCTTTGGGTGAACTGCATAATGCTGCTG 524

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   505  NM_079878.3  CG2125-RA (ci), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   17  14  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   11  NM_132640.2  CG1770-RA, transcript variant A (HDAC4), mRNA 
0   11  NM_001014736.1  CG1770-RC, transcript variant C (HDAC4), mRNA 
0   11  NM_167356.1  CG1770-RB, transcript variant B (HDAC4), mRNA 
0   NM_134890.2  CG17265-RA (CG17265), mRNA 
0   NM_135186.1  CG16947-RA (CG16947), mRNA 
0   NM_141676.2  CG12950-RA (CG12950), mRNA 
0   NM_136646.1  CG13953-RA (CG13953), mRNA 
0   NM_176036.1  CG32973-RA (CG32973), mRNA 
0   NM_079416.2  CG4166-RA (not), mRNA 
0   NM_170570.1  CG1873-RB, transcript variant B (Ef1alpha100E), mRNA 
0   NM_206592.1  CG1873-RD, transcript variant D (Ef1alpha100E), mRNA 
0   NM_079872.4  CG1873-RA, transcript variant A (Ef1alpha100E), mRNA 
0   NM_206593.1  CG1873-RC, transcript variant C (Ef1alpha100E), mRNA 
0   NM_137507.3  CG5341-RA (sec6), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   NM_138052.2  CG3356-RA (CG3356), mRNA 
0   NM_141458.2  CG32466-RA, transcript variant A (rn), mRNA 
0   NM_169170.1  CG1070-RC, transcript variant C (Alh), mRNA 
0   NM_169171.1  CG1070-RD, transcript variant D (Alh), mRNA 
0   NM_079526.2  CG1070-RA, transcript variant A (Alh), mRNA 
0   NM_169172.1  CG1070-RB, transcript variant B (Alh), mRNA 
0   NM_057338.2  CG8246-RA (Poxn), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.